Incidental Mutation 'R8788:Fat2'
ID 670771
Institutional Source Beutler Lab
Gene Symbol Fat2
Ensembl Gene ENSMUSG00000055333
Gene Name FAT atypical cadherin 2
Synonyms LOC245827, mKIAA0811, EMI2, Fath2
MMRRC Submission 068607-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8788 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 55141435-55227390 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55171929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 2928 (A2928D)
Ref Sequence ENSEMBL: ENSMUSP00000067556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068853] [ENSMUST00000108864]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068853
AA Change: A2928D

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067556
Gene: ENSMUSG00000055333
AA Change: A2928D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108864
AA Change: A2928D

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104492
Gene: ENSMUSG00000055333
AA Change: A2928D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy, fertile and overtly normal, with no apparent defects in the development of red blood cells or platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 A T 10: 69,718,256 (GRCm39) L502F unknown Het
Btbd8 A G 5: 107,618,853 (GRCm39) *252W probably null Het
Btnl9 T A 11: 49,066,614 (GRCm39) M336L probably benign Het
Cd72 T C 4: 43,450,185 (GRCm39) E241G probably benign Het
Cdh23 T A 10: 60,324,372 (GRCm39) N296I probably damaging Het
Celf6 C A 9: 59,485,750 (GRCm39) S30R possibly damaging Het
Crxos T C 7: 15,632,499 (GRCm39) Y102H probably benign Het
Csmd3 A T 15: 47,470,513 (GRCm39) S2477T Het
Evi2a T A 11: 79,418,531 (GRCm39) R26S probably benign Het
Ezr T C 17: 7,021,392 (GRCm39) M182V probably benign Het
Fetub A T 16: 22,758,182 (GRCm39) K322* probably null Het
Fscb T C 12: 64,518,395 (GRCm39) T1024A unknown Het
Gdpd1 A G 11: 86,950,318 (GRCm39) V85A probably damaging Het
Gm38119 G T 3: 92,645,537 (GRCm39) P19H unknown Het
Gpr182 T C 10: 127,586,529 (GRCm39) T141A probably benign Het
Inpp5d G A 1: 87,611,484 (GRCm39) G312D probably damaging Het
Kif26b G A 1: 178,357,090 (GRCm39) probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Maf T A 8: 116,432,612 (GRCm39) I331F probably damaging Het
Mark3 C A 12: 111,613,124 (GRCm39) S529R probably benign Het
Mmp10 A G 9: 7,502,687 (GRCm39) probably benign Het
Mrps30 T C 13: 118,523,538 (GRCm39) E78G possibly damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nhsl3 A G 4: 129,119,743 (GRCm39) V97A probably benign Het
Or4c116 T C 2: 88,942,626 (GRCm39) T77A probably benign Het
Pcdh12 G A 18: 38,416,109 (GRCm39) L339F probably benign Het
Pdgfd A G 9: 6,377,000 (GRCm39) S365G probably benign Het
Piezo1 T C 8: 123,228,533 (GRCm39) M281V Het
Prkg2 C T 5: 99,117,839 (GRCm39) E501K probably damaging Het
Recql5 T C 11: 115,786,628 (GRCm39) I563V probably benign Het
Rfx7 T C 9: 72,524,795 (GRCm39) S662P probably benign Het
Ric8a A G 7: 140,438,806 (GRCm39) T252A probably benign Het
Sbf1 C T 15: 89,186,062 (GRCm39) R984H probably damaging Het
Sel1l3 G T 5: 53,332,148 (GRCm39) Y412* probably null Het
Slc17a6 G A 7: 51,298,908 (GRCm39) A224T probably damaging Het
Slco1a8 A T 6: 141,933,570 (GRCm39) V425D probably benign Het
Smarca4 T C 9: 21,550,024 (GRCm39) I378T probably damaging Het
Tatdn1 T C 15: 58,762,543 (GRCm39) *265W probably null Het
Tcaf2 A G 6: 42,606,472 (GRCm39) L494P probably damaging Het
Tcl1b2 T C 12: 105,113,380 (GRCm39) L11P probably benign Het
Thrb A G 14: 18,002,558 (GRCm38) E119G probably damaging Het
Tll2 T C 19: 41,109,814 (GRCm39) T317A probably benign Het
Tob2 AGATGATGA AGATGA 15: 81,735,928 (GRCm39) probably benign Het
Upk1b A G 16: 38,607,463 (GRCm39) L88P probably damaging Het
Uri1 T C 7: 37,661,003 (GRCm39) I30V Het
Ush2a A T 1: 188,475,816 (GRCm39) R2918* probably null Het
Vax1 T C 19: 59,158,247 (GRCm39) D72G unknown Het
Vmn2r38 C A 7: 9,078,482 (GRCm39) M633I probably benign Het
Vmn2r95 A G 17: 18,671,790 (GRCm39) D581G probably benign Het
Vps13d A G 4: 144,813,305 (GRCm39) F3324L Het
Xrcc6 C T 15: 81,911,583 (GRCm39) L309F probably damaging Het
Xrra1 A G 7: 99,555,761 (GRCm39) Y376C probably benign Het
Zfp329 T C 7: 12,544,490 (GRCm39) T345A possibly damaging Het
Zfp574 T A 7: 24,779,816 (GRCm39) N279K unknown Het
Zfp804b T C 5: 6,822,635 (GRCm39) M143V probably benign Het
Other mutations in Fat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Fat2 APN 11 55,202,070 (GRCm39) missense probably benign
IGL00897:Fat2 APN 11 55,180,078 (GRCm39) missense probably damaging 0.99
IGL01161:Fat2 APN 11 55,175,017 (GRCm39) missense probably benign
IGL01306:Fat2 APN 11 55,201,698 (GRCm39) missense probably benign 0.28
IGL01393:Fat2 APN 11 55,160,135 (GRCm39) missense probably benign 0.00
IGL01529:Fat2 APN 11 55,172,982 (GRCm39) missense probably damaging 1.00
IGL01530:Fat2 APN 11 55,174,213 (GRCm39) missense probably benign 0.42
IGL01555:Fat2 APN 11 55,169,756 (GRCm39) missense probably damaging 0.99
IGL01758:Fat2 APN 11 55,187,035 (GRCm39) missense probably damaging 1.00
IGL01768:Fat2 APN 11 55,153,394 (GRCm39) missense probably damaging 1.00
IGL01939:Fat2 APN 11 55,174,806 (GRCm39) missense probably benign 0.01
IGL01941:Fat2 APN 11 55,202,831 (GRCm39) missense probably benign 0.01
IGL01967:Fat2 APN 11 55,202,649 (GRCm39) missense probably damaging 1.00
IGL01978:Fat2 APN 11 55,160,972 (GRCm39) missense probably benign 0.34
IGL01998:Fat2 APN 11 55,187,021 (GRCm39) missense probably benign 0.00
IGL02001:Fat2 APN 11 55,203,071 (GRCm39) start codon destroyed probably null 0.89
IGL02004:Fat2 APN 11 55,173,666 (GRCm39) missense probably damaging 1.00
IGL02103:Fat2 APN 11 55,180,122 (GRCm39) missense probably damaging 0.96
IGL02131:Fat2 APN 11 55,199,868 (GRCm39) missense probably damaging 1.00
IGL02155:Fat2 APN 11 55,153,245 (GRCm39) missense probably benign 0.00
IGL02223:Fat2 APN 11 55,163,955 (GRCm39) missense probably benign 0.01
IGL02231:Fat2 APN 11 55,171,918 (GRCm39) missense probably damaging 0.98
IGL02312:Fat2 APN 11 55,161,085 (GRCm39) missense probably damaging 1.00
IGL02476:Fat2 APN 11 55,201,950 (GRCm39) missense probably damaging 1.00
IGL02539:Fat2 APN 11 55,172,619 (GRCm39) missense probably damaging 1.00
IGL02553:Fat2 APN 11 55,202,109 (GRCm39) missense probably damaging 1.00
IGL02645:Fat2 APN 11 55,173,654 (GRCm39) missense probably damaging 1.00
IGL02664:Fat2 APN 11 55,201,922 (GRCm39) missense probably damaging 1.00
IGL02708:Fat2 APN 11 55,173,211 (GRCm39) missense probably damaging 0.99
IGL02883:Fat2 APN 11 55,147,444 (GRCm39) missense probably benign 0.16
IGL02894:Fat2 APN 11 55,147,479 (GRCm39) missense probably damaging 1.00
IGL02975:Fat2 APN 11 55,161,020 (GRCm39) missense probably benign 0.00
IGL03085:Fat2 APN 11 55,174,072 (GRCm39) missense probably benign 0.09
IGL03106:Fat2 APN 11 55,202,727 (GRCm39) missense probably benign 0.45
IGL03132:Fat2 APN 11 55,144,746 (GRCm39) missense probably benign 0.25
IGL03133:Fat2 APN 11 55,176,869 (GRCm39) missense probably benign 0.01
IGL03194:Fat2 APN 11 55,201,821 (GRCm39) missense probably benign 0.02
IGL03266:Fat2 APN 11 55,174,855 (GRCm39) missense possibly damaging 0.62
IGL03290:Fat2 APN 11 55,147,045 (GRCm39) missense probably benign 0.33
IGL03291:Fat2 APN 11 55,153,421 (GRCm39) missense probably benign
IGL03325:Fat2 APN 11 55,173,168 (GRCm39) missense probably damaging 1.00
IGL03345:Fat2 APN 11 55,173,187 (GRCm39) missense probably damaging 1.00
IGL03371:Fat2 APN 11 55,201,990 (GRCm39) missense probably benign 0.10
ANU23:Fat2 UTSW 11 55,201,698 (GRCm39) missense probably benign 0.28
BB001:Fat2 UTSW 11 55,153,613 (GRCm39) missense probably benign 0.03
BB011:Fat2 UTSW 11 55,153,613 (GRCm39) missense probably benign 0.03
P0040:Fat2 UTSW 11 55,173,039 (GRCm39) missense possibly damaging 0.89
PIT4504001:Fat2 UTSW 11 55,146,936 (GRCm39) missense possibly damaging 0.68
R0008:Fat2 UTSW 11 55,202,075 (GRCm39) missense probably damaging 1.00
R0008:Fat2 UTSW 11 55,202,075 (GRCm39) missense probably damaging 1.00
R0012:Fat2 UTSW 11 55,153,697 (GRCm39) missense probably benign 0.16
R0012:Fat2 UTSW 11 55,153,697 (GRCm39) missense probably benign 0.16
R0048:Fat2 UTSW 11 55,200,865 (GRCm39) missense probably benign 0.00
R0048:Fat2 UTSW 11 55,200,865 (GRCm39) missense probably benign 0.00
R0098:Fat2 UTSW 11 55,189,431 (GRCm39) missense probably damaging 0.98
R0124:Fat2 UTSW 11 55,174,504 (GRCm39) missense probably damaging 0.98
R0127:Fat2 UTSW 11 55,180,112 (GRCm39) missense probably benign 0.01
R0130:Fat2 UTSW 11 55,142,944 (GRCm39) missense probably benign 0.26
R0131:Fat2 UTSW 11 55,164,037 (GRCm39) missense probably benign
R0158:Fat2 UTSW 11 55,187,011 (GRCm39) missense probably benign 0.00
R0184:Fat2 UTSW 11 55,187,114 (GRCm39) missense probably damaging 1.00
R0367:Fat2 UTSW 11 55,182,919 (GRCm39) splice site probably benign
R0384:Fat2 UTSW 11 55,160,291 (GRCm39) missense possibly damaging 0.81
R0390:Fat2 UTSW 11 55,201,603 (GRCm39) missense probably damaging 0.99
R0403:Fat2 UTSW 11 55,161,175 (GRCm39) missense probably benign 0.42
R0416:Fat2 UTSW 11 55,174,960 (GRCm39) missense possibly damaging 0.94
R0437:Fat2 UTSW 11 55,173,625 (GRCm39) missense probably benign 0.02
R0463:Fat2 UTSW 11 55,153,655 (GRCm39) missense probably damaging 1.00
R0497:Fat2 UTSW 11 55,174,228 (GRCm39) missense probably benign 0.03
R0617:Fat2 UTSW 11 55,202,669 (GRCm39) missense possibly damaging 0.60
R0622:Fat2 UTSW 11 55,173,954 (GRCm39) missense probably damaging 1.00
R0675:Fat2 UTSW 11 55,200,035 (GRCm39) missense probably damaging 0.97
R0811:Fat2 UTSW 11 55,144,459 (GRCm39) missense possibly damaging 0.75
R0812:Fat2 UTSW 11 55,144,459 (GRCm39) missense possibly damaging 0.75
R0869:Fat2 UTSW 11 55,202,601 (GRCm39) missense probably benign 0.08
R0870:Fat2 UTSW 11 55,202,601 (GRCm39) missense probably benign 0.08
R0899:Fat2 UTSW 11 55,147,051 (GRCm39) missense probably damaging 1.00
R1278:Fat2 UTSW 11 55,159,005 (GRCm39) missense probably damaging 1.00
R1383:Fat2 UTSW 11 55,201,599 (GRCm39) missense probably benign
R1428:Fat2 UTSW 11 55,186,913 (GRCm39) missense probably damaging 1.00
R1438:Fat2 UTSW 11 55,178,637 (GRCm39) missense probably damaging 1.00
R1495:Fat2 UTSW 11 55,153,499 (GRCm39) missense probably benign
R1506:Fat2 UTSW 11 55,175,090 (GRCm39) missense probably benign
R1547:Fat2 UTSW 11 55,143,081 (GRCm39) missense probably benign 0.01
R1554:Fat2 UTSW 11 55,144,490 (GRCm39) missense probably benign 0.01
R1562:Fat2 UTSW 11 55,200,800 (GRCm39) missense probably damaging 1.00
R1588:Fat2 UTSW 11 55,174,230 (GRCm39) missense probably damaging 1.00
R1592:Fat2 UTSW 11 55,182,696 (GRCm39) splice site probably null
R1601:Fat2 UTSW 11 55,172,836 (GRCm39) missense probably benign 0.01
R1610:Fat2 UTSW 11 55,169,750 (GRCm39) missense probably damaging 1.00
R1634:Fat2 UTSW 11 55,175,545 (GRCm39) missense probably benign
R1634:Fat2 UTSW 11 55,158,510 (GRCm39) missense probably damaging 1.00
R1644:Fat2 UTSW 11 55,187,007 (GRCm39) missense possibly damaging 0.94
R1644:Fat2 UTSW 11 55,178,609 (GRCm39) missense possibly damaging 0.91
R1691:Fat2 UTSW 11 55,202,678 (GRCm39) missense probably damaging 0.99
R1734:Fat2 UTSW 11 55,172,197 (GRCm39) missense probably benign 0.00
R1748:Fat2 UTSW 11 55,147,473 (GRCm39) missense probably damaging 0.97
R1771:Fat2 UTSW 11 55,201,691 (GRCm39) missense probably benign 0.01
R1800:Fat2 UTSW 11 55,174,718 (GRCm39) missense probably damaging 1.00
R1807:Fat2 UTSW 11 55,180,085 (GRCm39) missense probably damaging 1.00
R1823:Fat2 UTSW 11 55,147,606 (GRCm39) missense probably benign 0.29
R1848:Fat2 UTSW 11 55,202,384 (GRCm39) missense probably damaging 1.00
R1866:Fat2 UTSW 11 55,182,840 (GRCm39) missense probably benign 0.00
R1899:Fat2 UTSW 11 55,153,004 (GRCm39) missense probably benign
R1954:Fat2 UTSW 11 55,201,910 (GRCm39) missense probably benign 0.06
R2010:Fat2 UTSW 11 55,144,653 (GRCm39) missense probably damaging 0.99
R2011:Fat2 UTSW 11 55,173,583 (GRCm39) missense probably damaging 1.00
R2057:Fat2 UTSW 11 55,172,686 (GRCm39) missense possibly damaging 0.60
R2081:Fat2 UTSW 11 55,200,503 (GRCm39) missense possibly damaging 0.94
R2106:Fat2 UTSW 11 55,147,390 (GRCm39) missense probably benign 0.00
R2165:Fat2 UTSW 11 55,194,542 (GRCm39) missense probably benign 0.00
R2176:Fat2 UTSW 11 55,158,401 (GRCm39) critical splice donor site probably null
R2284:Fat2 UTSW 11 55,173,186 (GRCm39) missense probably damaging 1.00
R2338:Fat2 UTSW 11 55,202,727 (GRCm39) missense possibly damaging 0.93
R2340:Fat2 UTSW 11 55,160,922 (GRCm39) missense possibly damaging 0.90
R2427:Fat2 UTSW 11 55,201,638 (GRCm39) missense probably benign 0.15
R2444:Fat2 UTSW 11 55,172,799 (GRCm39) missense probably damaging 1.00
R2858:Fat2 UTSW 11 55,174,599 (GRCm39) missense possibly damaging 0.94
R2882:Fat2 UTSW 11 55,202,131 (GRCm39) missense probably damaging 0.96
R3029:Fat2 UTSW 11 55,175,535 (GRCm39) missense probably damaging 1.00
R3085:Fat2 UTSW 11 55,142,997 (GRCm39) missense possibly damaging 0.79
R3121:Fat2 UTSW 11 55,202,622 (GRCm39) missense probably damaging 1.00
R3418:Fat2 UTSW 11 55,169,824 (GRCm39) missense probably benign 0.01
R3500:Fat2 UTSW 11 55,151,342 (GRCm39) missense probably damaging 0.99
R3607:Fat2 UTSW 11 55,172,511 (GRCm39) missense probably damaging 1.00
R3611:Fat2 UTSW 11 55,202,895 (GRCm39) missense probably benign
R3620:Fat2 UTSW 11 55,147,521 (GRCm39) missense probably damaging 0.97
R3688:Fat2 UTSW 11 55,171,927 (GRCm39) missense probably damaging 0.99
R3704:Fat2 UTSW 11 55,200,476 (GRCm39) missense probably damaging 1.00
R3784:Fat2 UTSW 11 55,147,012 (GRCm39) missense probably benign
R3889:Fat2 UTSW 11 55,172,589 (GRCm39) missense probably damaging 1.00
R3951:Fat2 UTSW 11 55,187,208 (GRCm39) missense probably benign 0.00
R4211:Fat2 UTSW 11 55,174,810 (GRCm39) missense probably damaging 1.00
R4249:Fat2 UTSW 11 55,175,127 (GRCm39) missense probably damaging 0.98
R4406:Fat2 UTSW 11 55,153,094 (GRCm39) missense probably benign 0.00
R4433:Fat2 UTSW 11 55,200,466 (GRCm39) missense possibly damaging 0.91
R4436:Fat2 UTSW 11 55,187,024 (GRCm39) missense probably damaging 1.00
R4498:Fat2 UTSW 11 55,160,923 (GRCm39) missense possibly damaging 0.90
R4560:Fat2 UTSW 11 55,156,777 (GRCm39) missense possibly damaging 0.89
R4594:Fat2 UTSW 11 55,175,578 (GRCm39) missense possibly damaging 0.78
R4663:Fat2 UTSW 11 55,187,039 (GRCm39) nonsense probably null
R4669:Fat2 UTSW 11 55,202,441 (GRCm39) missense probably benign 0.01
R4696:Fat2 UTSW 11 55,175,841 (GRCm39) missense probably benign 0.00
R4734:Fat2 UTSW 11 55,202,294 (GRCm39) missense probably benign 0.01
R4749:Fat2 UTSW 11 55,202,294 (GRCm39) missense probably benign 0.01
R4765:Fat2 UTSW 11 55,172,013 (GRCm39) missense probably damaging 1.00
R4803:Fat2 UTSW 11 55,175,886 (GRCm39) missense probably benign 0.03
R4805:Fat2 UTSW 11 55,174,805 (GRCm39) missense probably benign 0.01
R4822:Fat2 UTSW 11 55,202,144 (GRCm39) missense probably benign 0.02
R4840:Fat2 UTSW 11 55,169,844 (GRCm39) missense probably benign 0.21
R4849:Fat2 UTSW 11 55,201,463 (GRCm39) missense probably damaging 1.00
R4943:Fat2 UTSW 11 55,169,859 (GRCm39) missense probably benign 0.00
R4993:Fat2 UTSW 11 55,173,918 (GRCm39) missense probably damaging 0.99
R5097:Fat2 UTSW 11 55,201,530 (GRCm39) missense probably damaging 1.00
R5104:Fat2 UTSW 11 55,169,814 (GRCm39) missense possibly damaging 0.93
R5115:Fat2 UTSW 11 55,187,159 (GRCm39) missense probably damaging 1.00
R5213:Fat2 UTSW 11 55,144,658 (GRCm39) missense probably benign 0.00
R5254:Fat2 UTSW 11 55,172,001 (GRCm39) missense probably damaging 1.00
R5269:Fat2 UTSW 11 55,178,704 (GRCm39) missense probably benign 0.00
R5288:Fat2 UTSW 11 55,158,482 (GRCm39) missense probably benign 0.00
R5355:Fat2 UTSW 11 55,172,992 (GRCm39) missense probably damaging 1.00
R5375:Fat2 UTSW 11 55,153,646 (GRCm39) missense probably benign 0.00
R5379:Fat2 UTSW 11 55,194,767 (GRCm39) missense probably damaging 0.99
R5411:Fat2 UTSW 11 55,143,052 (GRCm39) missense probably benign 0.23
R5416:Fat2 UTSW 11 55,194,514 (GRCm39) missense possibly damaging 0.77
R5480:Fat2 UTSW 11 55,200,912 (GRCm39) missense probably damaging 0.99
R5486:Fat2 UTSW 11 55,144,507 (GRCm39) missense probably benign 0.00
R5526:Fat2 UTSW 11 55,160,187 (GRCm39) missense possibly damaging 0.90
R5532:Fat2 UTSW 11 55,153,163 (GRCm39) missense probably damaging 1.00
R5583:Fat2 UTSW 11 55,144,715 (GRCm39) missense probably benign 0.00
R5588:Fat2 UTSW 11 55,173,103 (GRCm39) missense probably damaging 1.00
R5598:Fat2 UTSW 11 55,171,956 (GRCm39) missense probably damaging 1.00
R5636:Fat2 UTSW 11 55,173,307 (GRCm39) missense probably damaging 1.00
R5653:Fat2 UTSW 11 55,201,142 (GRCm39) missense probably damaging 1.00
R5657:Fat2 UTSW 11 55,201,507 (GRCm39) nonsense probably null
R5660:Fat2 UTSW 11 55,175,002 (GRCm39) missense probably benign 0.00
R5752:Fat2 UTSW 11 55,180,063 (GRCm39) missense possibly damaging 0.48
R5757:Fat2 UTSW 11 55,143,172 (GRCm39) missense probably damaging 1.00
R5792:Fat2 UTSW 11 55,153,151 (GRCm39) missense possibly damaging 0.77
R5872:Fat2 UTSW 11 55,161,208 (GRCm39) missense probably damaging 1.00
R5933:Fat2 UTSW 11 55,174,877 (GRCm39) missense probably damaging 1.00
R6030:Fat2 UTSW 11 55,201,129 (GRCm39) nonsense probably null
R6030:Fat2 UTSW 11 55,201,129 (GRCm39) nonsense probably null
R6032:Fat2 UTSW 11 55,144,760 (GRCm39) missense probably damaging 1.00
R6032:Fat2 UTSW 11 55,144,760 (GRCm39) missense probably damaging 1.00
R6221:Fat2 UTSW 11 55,186,898 (GRCm39) critical splice donor site probably null
R6253:Fat2 UTSW 11 55,187,097 (GRCm39) missense probably damaging 1.00
R6257:Fat2 UTSW 11 55,153,407 (GRCm39) missense probably benign
R6307:Fat2 UTSW 11 55,172,106 (GRCm39) missense possibly damaging 0.63
R6450:Fat2 UTSW 11 55,180,136 (GRCm39) missense probably damaging 0.97
R6453:Fat2 UTSW 11 55,173,042 (GRCm39) missense probably benign 0.29
R6455:Fat2 UTSW 11 55,161,283 (GRCm39) missense probably damaging 0.96
R6483:Fat2 UTSW 11 55,187,171 (GRCm39) missense probably damaging 1.00
R6504:Fat2 UTSW 11 55,153,223 (GRCm39) missense probably benign 0.00
R6520:Fat2 UTSW 11 55,175,814 (GRCm39) missense probably damaging 0.99
R6525:Fat2 UTSW 11 55,174,626 (GRCm39) missense probably damaging 1.00
R6617:Fat2 UTSW 11 55,186,931 (GRCm39) missense probably benign 0.01
R6652:Fat2 UTSW 11 55,143,088 (GRCm39) missense probably benign
R6679:Fat2 UTSW 11 55,200,131 (GRCm39) missense probably damaging 1.00
R6680:Fat2 UTSW 11 55,201,684 (GRCm39) nonsense probably null
R6762:Fat2 UTSW 11 55,144,308 (GRCm39) splice site probably null
R6810:Fat2 UTSW 11 55,173,067 (GRCm39) missense possibly damaging 0.88
R6818:Fat2 UTSW 11 55,200,167 (GRCm39) missense probably benign 0.31
R6919:Fat2 UTSW 11 55,173,597 (GRCm39) missense possibly damaging 0.68
R6939:Fat2 UTSW 11 55,143,300 (GRCm39) nonsense probably null
R6941:Fat2 UTSW 11 55,152,914 (GRCm39) missense probably benign
R7023:Fat2 UTSW 11 55,201,328 (GRCm39) missense probably benign 0.00
R7027:Fat2 UTSW 11 55,160,259 (GRCm39) missense probably benign 0.03
R7027:Fat2 UTSW 11 55,172,677 (GRCm39) nonsense probably null
R7095:Fat2 UTSW 11 55,202,157 (GRCm39) missense probably damaging 1.00
R7102:Fat2 UTSW 11 55,174,260 (GRCm39) missense probably damaging 1.00
R7116:Fat2 UTSW 11 55,173,162 (GRCm39) missense probably damaging 1.00
R7117:Fat2 UTSW 11 55,172,088 (GRCm39) missense probably damaging 1.00
R7167:Fat2 UTSW 11 55,175,827 (GRCm39) missense possibly damaging 0.48
R7213:Fat2 UTSW 11 55,171,871 (GRCm39) nonsense probably null
R7246:Fat2 UTSW 11 55,187,208 (GRCm39) missense probably benign 0.00
R7252:Fat2 UTSW 11 55,202,088 (GRCm39) missense probably damaging 0.98
R7266:Fat2 UTSW 11 55,175,856 (GRCm39) missense probably damaging 0.99
R7316:Fat2 UTSW 11 55,176,893 (GRCm39) missense probably damaging 1.00
R7326:Fat2 UTSW 11 55,173,130 (GRCm39) missense probably damaging 0.99
R7355:Fat2 UTSW 11 55,147,377 (GRCm39) missense probably benign 0.00
R7431:Fat2 UTSW 11 55,199,927 (GRCm39) missense probably damaging 1.00
R7459:Fat2 UTSW 11 55,194,745 (GRCm39) missense probably damaging 1.00
R7460:Fat2 UTSW 11 55,169,789 (GRCm39) missense probably damaging 1.00
R7466:Fat2 UTSW 11 55,201,258 (GRCm39) missense probably damaging 1.00
R7475:Fat2 UTSW 11 55,194,479 (GRCm39) missense probably benign 0.31
R7678:Fat2 UTSW 11 55,173,156 (GRCm39) missense probably damaging 0.99
R7689:Fat2 UTSW 11 55,200,666 (GRCm39) missense probably damaging 1.00
R7704:Fat2 UTSW 11 55,175,173 (GRCm39) missense probably benign 0.03
R7710:Fat2 UTSW 11 55,201,589 (GRCm39) missense probably benign 0.35
R7724:Fat2 UTSW 11 55,175,622 (GRCm39) missense probably damaging 1.00
R7731:Fat2 UTSW 11 55,201,532 (GRCm39) missense probably damaging 1.00
R7739:Fat2 UTSW 11 55,171,957 (GRCm39) nonsense probably null
R7757:Fat2 UTSW 11 55,202,247 (GRCm39) missense probably benign 0.00
R7876:Fat2 UTSW 11 55,202,046 (GRCm39) missense probably benign 0.01
R7883:Fat2 UTSW 11 55,144,190 (GRCm39) splice site probably null
R7924:Fat2 UTSW 11 55,153,613 (GRCm39) missense probably benign 0.03
R7936:Fat2 UTSW 11 55,201,986 (GRCm39) nonsense probably null
R7936:Fat2 UTSW 11 55,200,993 (GRCm39) missense probably benign
R7938:Fat2 UTSW 11 55,163,922 (GRCm39) missense probably damaging 1.00
R7947:Fat2 UTSW 11 55,178,560 (GRCm39) missense probably damaging 1.00
R8049:Fat2 UTSW 11 55,202,892 (GRCm39) missense probably benign 0.13
R8094:Fat2 UTSW 11 55,186,965 (GRCm39) missense probably benign 0.06
R8157:Fat2 UTSW 11 55,142,910 (GRCm39) missense possibly damaging 0.90
R8170:Fat2 UTSW 11 55,161,281 (GRCm39) missense probably damaging 1.00
R8172:Fat2 UTSW 11 55,178,638 (GRCm39) missense probably damaging 1.00
R8182:Fat2 UTSW 11 55,175,223 (GRCm39) missense possibly damaging 0.51
R8188:Fat2 UTSW 11 55,163,997 (GRCm39) missense probably damaging 0.98
R8204:Fat2 UTSW 11 55,175,436 (GRCm39) missense probably benign 0.02
R8211:Fat2 UTSW 11 55,203,035 (GRCm39) missense possibly damaging 0.92
R8255:Fat2 UTSW 11 55,161,101 (GRCm39) missense probably benign 0.19
R8263:Fat2 UTSW 11 55,174,962 (GRCm39) missense probably benign
R8269:Fat2 UTSW 11 55,173,535 (GRCm39) missense possibly damaging 0.48
R8443:Fat2 UTSW 11 55,202,535 (GRCm39) missense probably damaging 1.00
R8465:Fat2 UTSW 11 55,147,530 (GRCm39) missense possibly damaging 0.61
R8480:Fat2 UTSW 11 55,173,794 (GRCm39) missense possibly damaging 0.61
R8511:Fat2 UTSW 11 55,200,063 (GRCm39) missense probably damaging 0.99
R8680:Fat2 UTSW 11 55,144,692 (GRCm39) missense probably benign
R8704:Fat2 UTSW 11 55,172,137 (GRCm39) missense probably damaging 1.00
R8711:Fat2 UTSW 11 55,159,129 (GRCm39) missense probably benign 0.22
R8724:Fat2 UTSW 11 55,173,786 (GRCm39) missense probably damaging 1.00
R8802:Fat2 UTSW 11 55,173,750 (GRCm39) missense possibly damaging 0.95
R8902:Fat2 UTSW 11 55,200,896 (GRCm39) missense probably damaging 1.00
R8940:Fat2 UTSW 11 55,147,636 (GRCm39) missense possibly damaging 0.48
R8956:Fat2 UTSW 11 55,173,729 (GRCm39) missense probably damaging 1.00
R9035:Fat2 UTSW 11 55,194,547 (GRCm39) missense probably damaging 0.99
R9100:Fat2 UTSW 11 55,153,347 (GRCm39) missense probably damaging 1.00
R9132:Fat2 UTSW 11 55,189,436 (GRCm39) missense possibly damaging 0.88
R9173:Fat2 UTSW 11 55,169,763 (GRCm39) missense probably damaging 1.00
R9241:Fat2 UTSW 11 55,147,566 (GRCm39) missense probably benign 0.00
R9253:Fat2 UTSW 11 55,201,397 (GRCm39) missense probably damaging 1.00
R9280:Fat2 UTSW 11 55,201,523 (GRCm39) missense probably benign 0.36
R9351:Fat2 UTSW 11 55,172,127 (GRCm39) missense probably damaging 1.00
R9369:Fat2 UTSW 11 55,201,514 (GRCm39) missense possibly damaging 0.67
R9404:Fat2 UTSW 11 55,144,348 (GRCm39) critical splice donor site probably null
R9431:Fat2 UTSW 11 55,142,838 (GRCm39) missense probably damaging 1.00
R9484:Fat2 UTSW 11 55,200,752 (GRCm39) missense probably damaging 0.99
R9509:Fat2 UTSW 11 55,200,713 (GRCm39) missense possibly damaging 0.51
R9514:Fat2 UTSW 11 55,175,808 (GRCm39) missense probably damaging 0.98
R9606:Fat2 UTSW 11 55,180,093 (GRCm39) missense probably damaging 1.00
R9630:Fat2 UTSW 11 55,147,605 (GRCm39) missense probably benign 0.29
R9727:Fat2 UTSW 11 55,159,137 (GRCm39) missense probably damaging 1.00
R9736:Fat2 UTSW 11 55,194,751 (GRCm39) missense probably damaging 1.00
X0010:Fat2 UTSW 11 55,143,086 (GRCm39) missense probably benign 0.00
X0011:Fat2 UTSW 11 55,201,257 (GRCm39) missense probably damaging 0.98
X0018:Fat2 UTSW 11 55,187,036 (GRCm39) missense probably damaging 1.00
X0028:Fat2 UTSW 11 55,200,240 (GRCm39) missense possibly damaging 0.84
X0067:Fat2 UTSW 11 55,174,060 (GRCm39) missense possibly damaging 0.48
Z1176:Fat2 UTSW 11 55,175,817 (GRCm39) missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55,173,621 (GRCm39) missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55,200,947 (GRCm39) missense probably damaging 0.96
Z1176:Fat2 UTSW 11 55,194,526 (GRCm39) missense probably damaging 1.00
Z1177:Fat2 UTSW 11 55,169,792 (GRCm39) nonsense probably null
Z1186:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1186:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Z1187:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1187:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Z1188:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1188:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Z1189:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1189:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Z1190:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1190:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Z1191:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1191:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Z1192:Fat2 UTSW 11 55,200,625 (GRCm39) missense probably benign
Z1192:Fat2 UTSW 11 55,199,796 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCAAGTGTCTGAATGGAACC -3'
(R):5'- CACTCCAAGAACTCGACTGTG -3'

Sequencing Primer
(F):5'- TGTCTGAATGGAACCACTGAGATCC -3'
(R):5'- TGTGAGACTCAGCAGACTTACCG -3'
Posted On 2021-04-30