Incidental Mutation 'R0733:Slco6d1'
ID67079
Institutional Source Beutler Lab
Gene Symbol Slco6d1
Ensembl Gene ENSMUSG00000026336
Gene Namesolute carrier organic anion transporter family, member 6d1
Synonyms4921511I05Rik
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0733 (G1)
Quality Score203
Status Validated
Chromosome1
Chromosomal Location98421124-98516991 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 98428269 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 143 (L143*)
Ref Sequence ENSEMBL: ENSMUSP00000125258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027575] [ENSMUST00000160796] [ENSMUST00000162468]
Predicted Effect probably null
Transcript: ENSMUST00000027575
AA Change: L186*
SMART Domains Protein: ENSMUSP00000027575
Gene: ENSMUSG00000026336
AA Change: L186*

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 1.8e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160796
AA Change: L186*
SMART Domains Protein: ENSMUSP00000123850
Gene: ENSMUSG00000026336
AA Change: L186*

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 2.4e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162468
AA Change: L143*
SMART Domains Protein: ENSMUSP00000125258
Gene: ENSMUSG00000026336
AA Change: L143*

DomainStartEndE-ValueType
Pfam:OATP 64 313 2.1e-27 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Slco6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slco6d1 APN 1 98432230 splice site probably null
IGL00678:Slco6d1 APN 1 98496344 missense probably benign 0.01
IGL00790:Slco6d1 APN 1 98421200 utr 5 prime probably benign
IGL01694:Slco6d1 APN 1 98499845 missense probably damaging 1.00
IGL02003:Slco6d1 APN 1 98480768 missense probably damaging 1.00
IGL02059:Slco6d1 APN 1 98446806 missense possibly damaging 0.95
IGL02085:Slco6d1 APN 1 98443743 missense probably damaging 1.00
IGL02683:Slco6d1 APN 1 98480672 missense probably benign 0.05
IGL02736:Slco6d1 APN 1 98428311 missense possibly damaging 0.55
IGL03279:Slco6d1 APN 1 98466680 missense probably damaging 1.00
PIT4581001:Slco6d1 UTSW 1 98423325 missense possibly damaging 0.46
R0326:Slco6d1 UTSW 1 98490634 missense probably benign 0.02
R0359:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0554:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0589:Slco6d1 UTSW 1 98499747 splice site probably benign
R0883:Slco6d1 UTSW 1 98421399 missense probably benign 0.00
R1316:Slco6d1 UTSW 1 98466793 missense probably benign 0.02
R1370:Slco6d1 UTSW 1 98423094 missense probably benign 0.01
R1401:Slco6d1 UTSW 1 98490616 missense probably damaging 1.00
R1691:Slco6d1 UTSW 1 98507567 missense probably benign 0.34
R1740:Slco6d1 UTSW 1 98428372 missense probably damaging 1.00
R1767:Slco6d1 UTSW 1 98490549 missense possibly damaging 0.90
R1827:Slco6d1 UTSW 1 98421216 missense probably damaging 0.96
R2138:Slco6d1 UTSW 1 98443660 missense probably benign 0.19
R2849:Slco6d1 UTSW 1 98466716 missense probably benign 0.02
R3753:Slco6d1 UTSW 1 98499777 missense probably damaging 0.99
R4066:Slco6d1 UTSW 1 98463846 critical splice acceptor site probably benign
R4429:Slco6d1 UTSW 1 98496366 missense possibly damaging 0.66
R4480:Slco6d1 UTSW 1 98507574 nonsense probably null
R4656:Slco6d1 UTSW 1 98423203 missense probably benign 0.06
R4810:Slco6d1 UTSW 1 98423254 missense possibly damaging 0.83
R4814:Slco6d1 UTSW 1 98423174 missense probably benign 0.15
R5389:Slco6d1 UTSW 1 98443644 missense probably benign 0.00
R5504:Slco6d1 UTSW 1 98421339 missense probably damaging 0.99
R5619:Slco6d1 UTSW 1 98496222 missense probably damaging 1.00
R5688:Slco6d1 UTSW 1 98480768 missense probably damaging 1.00
R5820:Slco6d1 UTSW 1 98499778 missense probably damaging 0.97
R5878:Slco6d1 UTSW 1 98463836 splice site probably benign
R6261:Slco6d1 UTSW 1 98499863 missense probably benign 0.10
R6450:Slco6d1 UTSW 1 98421467 missense probably benign 0.29
R6452:Slco6d1 UTSW 1 98421212 missense probably benign 0.44
R7338:Slco6d1 UTSW 1 98421372 missense probably benign 0.11
R7375:Slco6d1 UTSW 1 98421447 missense probably damaging 1.00
R7456:Slco6d1 UTSW 1 98421357 missense possibly damaging 0.66
R7567:Slco6d1 UTSW 1 98497527 missense probably damaging 1.00
R7729:Slco6d1 UTSW 1 98497523 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGTTCAGTGGTGGACTATCCAGGGC -3'
(R):5'- AATCCAGATGAGTTTGTGGGAACGTG -3'

Sequencing Primer
(F):5'- GTGGACTATCCAGGGCATTAC -3'
(R):5'- CGTGGTCAAAAATAAAGCTTGTG -3'
Posted On2013-09-03