Incidental Mutation 'R8789:Tsc22d2'
ID670801
Institutional Source Beutler Lab
Gene Symbol Tsc22d2
Ensembl Gene ENSMUSG00000027806
Gene NameTSC22 domain family, member 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R8789 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location58414715-58466783 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58460017 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 663 (K663*)
Ref Sequence ENSEMBL: ENSMUSP00000143364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099090] [ENSMUST00000199164]
Predicted Effect probably null
Transcript: ENSMUST00000099090
AA Change: K687*
SMART Domains Protein: ENSMUSP00000096688
Gene: ENSMUSG00000027806
AA Change: K687*

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 683 739 4.1e-29 PFAM
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196049
Predicted Effect probably null
Transcript: ENSMUST00000199164
AA Change: K663*
SMART Domains Protein: ENSMUSP00000143364
Gene: ENSMUSG00000027806
AA Change: K663*

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 659 718 1.2e-28 PFAM
low complexity region 722 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,843,001 I114T probably benign Het
Actr5 C T 2: 158,636,684 Q485* probably null Het
Arsa C T 15: 89,474,057 V350I probably benign Het
AW822073 T C 10: 58,223,604 N443D unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cav2 T C 6: 17,281,997 Y85H probably damaging Het
Ccdc93 A G 1: 121,497,055 Q570R probably damaging Het
Cd72 A G 4: 43,452,628 S122P probably damaging Het
Cep72 A G 13: 74,038,248 M619T possibly damaging Het
Cers5 C A 15: 99,739,670 V233F possibly damaging Het
Cntn5 A G 9: 9,673,287 Y803H probably damaging Het
Crybg2 T C 4: 134,074,243 S596P probably benign Het
Crybg3 T C 16: 59,554,996 E251G probably benign Het
Csmd1 T A 8: 17,216,706 N68I probably damaging Het
Ctr9 A G 7: 111,043,726 N466S possibly damaging Het
Cyp2a4 T A 7: 26,307,681 I71N probably damaging Het
Cyp2j11 C T 4: 96,339,168 E204K probably damaging Het
Cyp4f39 T C 17: 32,491,874 F469S probably damaging Het
Dmac2 T A 7: 25,621,070 S65T probably benign Het
Elp3 G A 14: 65,565,421 P243S probably damaging Het
Foxg1 T A 12: 49,385,360 M292K probably benign Het
Fsip2 T C 2: 82,985,478 S3852P possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm10912 A C 2: 104,066,701 K62Q possibly damaging Het
Grk2 G A 19: 4,288,483 R474C probably damaging Het
Hoxc12 T C 15: 102,938,297 I208T probably benign Het
Itgal A G 7: 127,305,249 H298R probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Olfr159 A T 4: 43,770,793 C73S probably damaging Het
Olfr373 T C 8: 72,100,291 F177S probably damaging Het
Phrf1 T A 7: 141,256,668 D284E unknown Het
Pmp2 T A 3: 10,182,504 I42F probably damaging Het
Psg26 T C 7: 18,482,569 D115G probably damaging Het
Pym1 T C 10: 128,765,204 V32A probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Recql4 T C 15: 76,704,346 H1105R probably benign Het
Rimkla T C 4: 119,492,410 Y17C probably damaging Het
Rnf207 C T 4: 152,307,467 R623K probably benign Het
Ros1 A T 10: 52,123,232 N1207K probably damaging Het
Scg2 G T 1: 79,435,783 Q368K probably benign Het
Serpinb6e G A 13: 33,833,230 T269I probably damaging Het
Ubr4 T A 4: 139,410,183 N1026K possibly damaging Het
Ubtfl1 A G 9: 18,410,313 D379G unknown Het
Vps13d T C 4: 145,069,173 M3700V Het
Zscan4-ps3 T C 7: 11,612,361 L136P probably damaging Het
Other mutations in Tsc22d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tsc22d2 APN 3 58417415 unclassified probably benign
IGL01389:Tsc22d2 APN 3 58416238 missense probably damaging 0.98
IGL01407:Tsc22d2 APN 3 58416503 missense probably damaging 0.99
IGL02193:Tsc22d2 APN 3 58460207 utr 3 prime probably benign
IGL02641:Tsc22d2 APN 3 58416155 missense probably damaging 1.00
IGL02956:Tsc22d2 APN 3 58417546 missense unknown
R0141:Tsc22d2 UTSW 3 58417156 unclassified probably benign
R0421:Tsc22d2 UTSW 3 58417328 unclassified probably benign
R1743:Tsc22d2 UTSW 3 58417539 frame shift probably null
R2214:Tsc22d2 UTSW 3 58416206 missense probably damaging 1.00
R5155:Tsc22d2 UTSW 3 58417316 unclassified probably benign
R5242:Tsc22d2 UTSW 3 58415939 missense possibly damaging 0.86
R5616:Tsc22d2 UTSW 3 58417162 unclassified probably benign
R6119:Tsc22d2 UTSW 3 58460253 utr 3 prime probably benign
R6454:Tsc22d2 UTSW 3 58415840 missense possibly damaging 0.92
R6855:Tsc22d2 UTSW 3 58416814 missense probably damaging 0.99
R6885:Tsc22d2 UTSW 3 58416208 missense probably damaging 1.00
R7148:Tsc22d2 UTSW 3 58417008 nonsense probably null
R7243:Tsc22d2 UTSW 3 58416463 missense unknown
R8078:Tsc22d2 UTSW 3 58416032 missense probably benign 0.04
R8309:Tsc22d2 UTSW 3 58417123 missense unknown
Z1176:Tsc22d2 UTSW 3 58417024 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGAGCACTTTCTATACTAGCTG -3'
(R):5'- TTGAGAAGTGCTACCAGGATTG -3'

Sequencing Primer
(F):5'- AGGCCCTGTTAAGATATCGC -3'
(R):5'- GAGTTGGGACAACTGATCAT -3'
Posted On2021-04-30