Incidental Mutation 'R0733:Acbd3'
ID67081
Institutional Source Beutler Lab
Gene Symbol Acbd3
Ensembl Gene ENSMUSG00000026499
Gene Nameacyl-Coenzyme A binding domain containing 3
SynonymsD1Ertd10e, 8430407O11Rik, Pap7, Gocap1
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0733 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180726043-180754204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180752218 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 476 (I476V)
Ref Sequence ENSEMBL: ENSMUSP00000027780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027780
AA Change: I476V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027780
Gene: ENSMUSG00000026499
AA Change: I476V

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ACBP 81 167 3.2e-18 PFAM
coiled coil region 173 252 N/A INTRINSIC
low complexity region 268 305 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Pfam:GOLD_2 394 524 2.5e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192748
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Acbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Acbd3 APN 1 180745105 missense possibly damaging 0.61
R0321:Acbd3 UTSW 1 180752305 missense probably damaging 1.00
R0365:Acbd3 UTSW 1 180738612 missense probably damaging 1.00
R0524:Acbd3 UTSW 1 180747059 small deletion probably benign
R0884:Acbd3 UTSW 1 180747059 small deletion probably benign
R1074:Acbd3 UTSW 1 180738548 nonsense probably null
R1327:Acbd3 UTSW 1 180733183 missense possibly damaging 0.95
R1352:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R1820:Acbd3 UTSW 1 180745138 missense probably benign 0.13
R4697:Acbd3 UTSW 1 180721944 unclassified probably benign
R5187:Acbd3 UTSW 1 180736732 nonsense probably null
R5217:Acbd3 UTSW 1 180726373 missense probably benign 0.18
R5368:Acbd3 UTSW 1 180722095 unclassified probably benign
R6018:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R7072:Acbd3 UTSW 1 180726369 missense probably benign
R7366:Acbd3 UTSW 1 180734499 missense probably benign 0.41
X0027:Acbd3 UTSW 1 180747030 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAACTGTACATGGTGGTGGTCAGG -3'
(R):5'- CATGTTGTGCTCAACCCTAGACTCC -3'

Sequencing Primer
(F):5'- ATGACGAACATGCGCCTG -3'
(R):5'- TCCCGACCCTGGAACAG -3'
Posted On2013-09-03