Incidental Mutation 'R8789:Phrf1'
ID670818
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene NamePHD and ring finger domains 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8789 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141228784-141262750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141256668 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 284 (D284E)
Ref Sequence ENSEMBL: ENSMUSP00000113195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000132540] [ENSMUST00000155123]
Predicted Effect unknown
Transcript: ENSMUST00000106027
AA Change: D443E
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: D443E

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000122143
AA Change: D284E
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611
AA Change: D284E

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130687
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000132540
AA Change: D83E
Predicted Effect probably benign
Transcript: ENSMUST00000142572
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,843,001 I114T probably benign Het
Actr5 C T 2: 158,636,684 Q485* probably null Het
Arsa C T 15: 89,474,057 V350I probably benign Het
AW822073 T C 10: 58,223,604 N443D unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cav2 T C 6: 17,281,997 Y85H probably damaging Het
Ccdc93 A G 1: 121,497,055 Q570R probably damaging Het
Cd72 A G 4: 43,452,628 S122P probably damaging Het
Cep72 A G 13: 74,038,248 M619T possibly damaging Het
Cers5 C A 15: 99,739,670 V233F possibly damaging Het
Cntn5 A G 9: 9,673,287 Y803H probably damaging Het
Crybg2 T C 4: 134,074,243 S596P probably benign Het
Crybg3 T C 16: 59,554,996 E251G probably benign Het
Csmd1 T A 8: 17,216,706 N68I probably damaging Het
Ctr9 A G 7: 111,043,726 N466S possibly damaging Het
Cyp2a4 T A 7: 26,307,681 I71N probably damaging Het
Cyp2j11 C T 4: 96,339,168 E204K probably damaging Het
Cyp4f39 T C 17: 32,491,874 F469S probably damaging Het
Dmac2 T A 7: 25,621,070 S65T probably benign Het
Elp3 G A 14: 65,565,421 P243S probably damaging Het
Foxg1 T A 12: 49,385,360 M292K probably benign Het
Fsip2 T C 2: 82,985,478 S3852P possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm10912 A C 2: 104,066,701 K62Q possibly damaging Het
Grk2 G A 19: 4,288,483 R474C probably damaging Het
Hoxc12 T C 15: 102,938,297 I208T probably benign Het
Itgal A G 7: 127,305,249 H298R probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Olfr159 A T 4: 43,770,793 C73S probably damaging Het
Olfr373 T C 8: 72,100,291 F177S probably damaging Het
Pmp2 T A 3: 10,182,504 I42F probably damaging Het
Psg26 T C 7: 18,482,569 D115G probably damaging Het
Pym1 T C 10: 128,765,204 V32A probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Recql4 T C 15: 76,704,346 H1105R probably benign Het
Rimkla T C 4: 119,492,410 Y17C probably damaging Het
Rnf207 C T 4: 152,307,467 R623K probably benign Het
Ros1 A T 10: 52,123,232 N1207K probably damaging Het
Scg2 G T 1: 79,435,783 Q368K probably benign Het
Serpinb6e G A 13: 33,833,230 T269I probably damaging Het
Tsc22d2 A T 3: 58,460,017 K663* probably null Het
Ubr4 T A 4: 139,410,183 N1026K possibly damaging Het
Ubtfl1 A G 9: 18,410,313 D379G unknown Het
Vps13d T C 4: 145,069,173 M3700V Het
Zscan4-ps3 T C 7: 11,612,361 L136P probably damaging Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 141258877 unclassified probably benign
IGL01391:Phrf1 APN 7 141262481 missense probably damaging 1.00
IGL01472:Phrf1 APN 7 141256490 splice site probably benign
IGL01633:Phrf1 APN 7 141260500 missense probably benign 0.43
IGL01808:Phrf1 APN 7 141260966 missense probably damaging 1.00
IGL02004:Phrf1 APN 7 141260333 missense probably benign 0.39
IGL02138:Phrf1 APN 7 141259283 unclassified probably benign
IGL02678:Phrf1 APN 7 141260282 missense probably damaging 1.00
IGL03077:Phrf1 APN 7 141254968 nonsense probably null
PIT4466001:Phrf1 UTSW 7 141258812 missense unknown
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0040:Phrf1 UTSW 7 141243857 missense probably damaging 1.00
R0358:Phrf1 UTSW 7 141258304 unclassified probably benign
R0445:Phrf1 UTSW 7 141247331 utr 3 prime probably benign
R0535:Phrf1 UTSW 7 141260065 missense probably benign 0.07
R0561:Phrf1 UTSW 7 141254963 missense probably benign 0.00
R0940:Phrf1 UTSW 7 141254855 splice site probably benign
R1499:Phrf1 UTSW 7 141256651 missense probably damaging 1.00
R1511:Phrf1 UTSW 7 141259801 unclassified probably benign
R1651:Phrf1 UTSW 7 141237521 missense probably benign
R1691:Phrf1 UTSW 7 141261874 nonsense probably null
R1778:Phrf1 UTSW 7 141232456 missense probably benign 0.01
R1851:Phrf1 UTSW 7 141240918 missense probably damaging 1.00
R2239:Phrf1 UTSW 7 141237692 missense probably damaging 1.00
R2857:Phrf1 UTSW 7 141259680 unclassified probably benign
R3796:Phrf1 UTSW 7 141259918 nonsense probably null
R3797:Phrf1 UTSW 7 141259918 nonsense probably null
R3798:Phrf1 UTSW 7 141259918 nonsense probably null
R3799:Phrf1 UTSW 7 141259918 nonsense probably null
R4080:Phrf1 UTSW 7 141259720 unclassified probably benign
R4081:Phrf1 UTSW 7 141259057 unclassified probably benign
R4557:Phrf1 UTSW 7 141258929 unclassified probably benign
R5217:Phrf1 UTSW 7 141260703 missense probably damaging 1.00
R5218:Phrf1 UTSW 7 141261301 missense possibly damaging 0.94
R5276:Phrf1 UTSW 7 141259283 unclassified probably benign
R5442:Phrf1 UTSW 7 141240937 missense probably damaging 1.00
R5501:Phrf1 UTSW 7 141259921 missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 141258465 unclassified probably benign
R5837:Phrf1 UTSW 7 141260061 missense probably benign 0.34
R5907:Phrf1 UTSW 7 141260540 missense possibly damaging 0.79
R5996:Phrf1 UTSW 7 141259102 unclassified probably benign
R6024:Phrf1 UTSW 7 141258985 unclassified probably benign
R6244:Phrf1 UTSW 7 141237673 missense probably damaging 1.00
R6512:Phrf1 UTSW 7 141260396 missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 141237563 missense probably damaging 0.98
R7311:Phrf1 UTSW 7 141240933 missense unknown
R7409:Phrf1 UTSW 7 141259292 missense unknown
R7517:Phrf1 UTSW 7 141256610 missense unknown
R7560:Phrf1 UTSW 7 141231225 critical splice acceptor site probably null
R7699:Phrf1 UTSW 7 141254929 missense unknown
R7700:Phrf1 UTSW 7 141254929 missense unknown
R7867:Phrf1 UTSW 7 141256611 missense unknown
R7895:Phrf1 UTSW 7 141259375 missense unknown
R8179:Phrf1 UTSW 7 141256580 missense unknown
R8705:Phrf1 UTSW 7 141258738 missense unknown
R8708:Phrf1 UTSW 7 141232533 missense unknown
R8748:Phrf1 UTSW 7 141258235 missense unknown
R8768:Phrf1 UTSW 7 141258738 missense unknown
R8859:Phrf1 UTSW 7 141256603 missense unknown
X0027:Phrf1 UTSW 7 141256568 missense probably benign
Z1176:Phrf1 UTSW 7 141243883 missense unknown
Z1176:Phrf1 UTSW 7 141258818 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTAAGTGCAATGTGCCCC -3'
(R):5'- TCTCCTCTTGGCACTCAGAG -3'

Sequencing Primer
(F):5'- GTCACGTTGGTTCAGAATGAAGTCAC -3'
(R):5'- CTCTTGGCACTCAGAGGGGAAG -3'
Posted On2021-04-30