Incidental Mutation 'R8789:Cep72'
ID670830
Institutional Source Beutler Lab
Gene Symbol Cep72
Ensembl Gene ENSMUSG00000021572
Gene Namecentrosomal protein 72
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8789 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74036500-74062299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74038248 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 619 (M619T)
Ref Sequence ENSEMBL: ENSMUSP00000037788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022057] [ENSMUST00000036456] [ENSMUST00000221122] [ENSMUST00000222609]
Predicted Effect probably benign
Transcript: ENSMUST00000022057
SMART Domains Protein: ENSMUSP00000022057
Gene: ENSMUSG00000021573

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:p25-alpha 51 212 3.7e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036456
AA Change: M619T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: M619T

DomainStartEndE-ValueType
LRR 52 73 2.92e1 SMART
LRR 74 96 5.34e-1 SMART
LRRcap 116 134 1.89e-4 SMART
low complexity region 307 319 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
coiled coil region 485 531 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221122
AA Change: M268T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000222609
Predicted Effect probably benign
Transcript: ENSMUST00000223028
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T C 16: 8,843,001 I114T probably benign Het
Actr5 C T 2: 158,636,684 Q485* probably null Het
Arsa C T 15: 89,474,057 V350I probably benign Het
AW822073 T C 10: 58,223,604 N443D unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cav2 T C 6: 17,281,997 Y85H probably damaging Het
Ccdc93 A G 1: 121,497,055 Q570R probably damaging Het
Cd72 A G 4: 43,452,628 S122P probably damaging Het
Cers5 C A 15: 99,739,670 V233F possibly damaging Het
Cntn5 A G 9: 9,673,287 Y803H probably damaging Het
Crybg2 T C 4: 134,074,243 S596P probably benign Het
Crybg3 T C 16: 59,554,996 E251G probably benign Het
Csmd1 T A 8: 17,216,706 N68I probably damaging Het
Ctr9 A G 7: 111,043,726 N466S possibly damaging Het
Cyp2a4 T A 7: 26,307,681 I71N probably damaging Het
Cyp2j11 C T 4: 96,339,168 E204K probably damaging Het
Cyp4f39 T C 17: 32,491,874 F469S probably damaging Het
Dmac2 T A 7: 25,621,070 S65T probably benign Het
Elp3 G A 14: 65,565,421 P243S probably damaging Het
Foxg1 T A 12: 49,385,360 M292K probably benign Het
Fsip2 T C 2: 82,985,478 S3852P possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm10912 A C 2: 104,066,701 K62Q possibly damaging Het
Grk2 G A 19: 4,288,483 R474C probably damaging Het
Hoxc12 T C 15: 102,938,297 I208T probably benign Het
Itgal A G 7: 127,305,249 H298R probably benign Het
Klrb1c A G 6: 128,784,185 S160P probably benign Het
Olfr159 A T 4: 43,770,793 C73S probably damaging Het
Olfr373 T C 8: 72,100,291 F177S probably damaging Het
Phrf1 T A 7: 141,256,668 D284E unknown Het
Pmp2 T A 3: 10,182,504 I42F probably damaging Het
Psg26 T C 7: 18,482,569 D115G probably damaging Het
Pym1 T C 10: 128,765,204 V32A probably benign Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Recql4 T C 15: 76,704,346 H1105R probably benign Het
Rimkla T C 4: 119,492,410 Y17C probably damaging Het
Rnf207 C T 4: 152,307,467 R623K probably benign Het
Ros1 A T 10: 52,123,232 N1207K probably damaging Het
Scg2 G T 1: 79,435,783 Q368K probably benign Het
Serpinb6e G A 13: 33,833,230 T269I probably damaging Het
Tsc22d2 A T 3: 58,460,017 K663* probably null Het
Ubr4 T A 4: 139,410,183 N1026K possibly damaging Het
Ubtfl1 A G 9: 18,410,313 D379G unknown Het
Vps13d T C 4: 145,069,173 M3700V Het
Zscan4-ps3 T C 7: 11,612,361 L136P probably damaging Het
Other mutations in Cep72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cep72 APN 13 74062268 unclassified probably benign
IGL01373:Cep72 APN 13 74059459 missense probably damaging 1.00
IGL02415:Cep72 APN 13 74050154 missense probably benign 0.31
IGL03372:Cep72 APN 13 74043518 missense possibly damaging 0.47
R0608:Cep72 UTSW 13 74038304 missense probably damaging 1.00
R0884:Cep72 UTSW 13 74054881 critical splice donor site probably null
R2400:Cep72 UTSW 13 74048977 missense probably damaging 0.99
R4906:Cep72 UTSW 13 74059465 missense probably damaging 1.00
R5534:Cep72 UTSW 13 74062216 missense probably benign 0.05
R5567:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5570:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5816:Cep72 UTSW 13 74049031 missense probably benign 0.43
R6310:Cep72 UTSW 13 74053025 missense possibly damaging 0.94
R6513:Cep72 UTSW 13 74058463 missense probably damaging 1.00
R6848:Cep72 UTSW 13 74038276 missense possibly damaging 0.85
R6936:Cep72 UTSW 13 74040087 missense probably damaging 1.00
R7000:Cep72 UTSW 13 74058325 missense probably damaging 0.96
R7006:Cep72 UTSW 13 74050308 nonsense probably null
R7074:Cep72 UTSW 13 74051580 missense probably benign 0.16
R7640:Cep72 UTSW 13 74058488 nonsense probably null
R7889:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
R8260:Cep72 UTSW 13 74058346 missense probably damaging 1.00
R8751:Cep72 UTSW 13 74050184 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGTCTCACTGGGGTACTTAGATAG -3'
(R):5'- ATAGCCTTGCACTGCTACAG -3'

Sequencing Primer
(F):5'- CTTAGATAGATGCATGCCCAGGTAC -3'
(R):5'- CACTGCTACAGTTAGGAGCATCTG -3'
Posted On2021-04-30