Incidental Mutation 'R8790:Ppdpf'
ID670848
Institutional Source Beutler Lab
Gene Symbol Ppdpf
Ensembl Gene ENSMUSG00000016344
Gene Namepancreatic progenitor cell differentiation and proliferation factor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8790 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181187247-181188771 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 181187853 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 34 (E34*)
Ref Sequence ENSEMBL: ENSMUSP00000016488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016488] [ENSMUST00000108841]
Predicted Effect probably null
Transcript: ENSMUST00000016488
AA Change: E34*
SMART Domains Protein: ENSMUSP00000016488
Gene: ENSMUSG00000016344
AA Change: E34*

DomainStartEndE-ValueType
Pfam:PPDFL 1 111 4.2e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108841
AA Change: E34*
SMART Domains Protein: ENSMUSP00000104469
Gene: ENSMUSG00000016344
AA Change: E34*

DomainStartEndE-ValueType
Pfam:PPDFL 1 112 1.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,092,451 P68S possibly damaging Het
Abcb5 T A 12: 118,867,885 N1244I possibly damaging Het
Abcb9 A G 5: 124,077,241 I479T probably damaging Het
Abi3bp A T 16: 56,675,074 I920F probably damaging Het
Adcy6 T A 15: 98,599,000 T465S probably damaging Het
Ankrd12 A T 17: 65,983,158 I1760N possibly damaging Het
Aoah C T 13: 20,851,670 R140C probably benign Het
Bmp7 T A 2: 172,870,267 D388V probably benign Het
Bphl C T 13: 34,060,485 A195V probably benign Het
Cckar A G 5: 53,699,949 V373A probably damaging Het
Cd79b T G 11: 106,312,047 D243A possibly damaging Het
Cdc25a T A 9: 109,887,348 probably null Het
Cfap57 T A 4: 118,581,914 Q805L possibly damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Cluap1 T A 16: 3,917,923 probably benign Het
D930020B18Rik G A 10: 121,667,663 G248S possibly damaging Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Dmkn G A 7: 30,764,024 S34N probably benign Het
Dnaaf2 T C 12: 69,197,294 D331G probably damaging Het
Dnah1 A T 14: 31,296,275 Y1429N possibly damaging Het
Dnajc5b T A 3: 19,546,817 L26Q probably damaging Het
Epb41l1 T G 2: 156,503,802 F242V possibly damaging Het
Esam A T 9: 37,531,631 I72F probably benign Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam98a A G 17: 75,547,689 F42L possibly damaging Het
Fras1 C T 5: 96,755,377 P3038S probably damaging Het
Gm32742 C A 9: 51,147,840 G1035C probably damaging Het
Jam2 T A 16: 84,809,371 I91K possibly damaging Het
Klhdc3 A G 17: 46,680,700 probably benign Het
Lgi1 C T 19: 38,300,848 S215F possibly damaging Het
Lrp1 G A 10: 127,539,077 T4504I probably damaging Het
Mafa T A 15: 75,747,375 H183L probably benign Het
Map2 T C 1: 66,438,838 V1773A probably damaging Het
Mesp1 G A 7: 79,793,077 R151* probably null Het
Mphosph9 T C 5: 124,315,673 D192G probably damaging Het
Mthfr C A 4: 148,055,534 D678E probably benign Het
Myo15 A C 11: 60,476,536 T41P possibly damaging Het
Myo15 G T 11: 60,487,221 R185L Het
Myom2 T G 8: 15,119,242 L1136W probably damaging Het
Naa30 A G 14: 49,180,751 D316G probably benign Het
Ngef T C 1: 87,477,597 Q697R probably benign Het
Nin T C 12: 70,021,019 R1945G Het
Obox8 A T 7: 14,332,983 Y45* probably null Het
Ocln C T 13: 100,506,219 V452I probably benign Het
Olfr1082 T C 2: 86,593,934 K298R possibly damaging Het
Olfr187 T C 16: 59,036,217 I173M possibly damaging Het
Olfr76 T C 19: 12,120,542 N57D probably damaging Het
Olfr967 T A 9: 39,750,908 I174K probably damaging Het
Oog3 T A 4: 144,159,140 D296V possibly damaging Het
Papln T C 12: 83,777,144 V499A probably benign Het
Paxip1 G T 5: 27,772,080 P328Q unknown Het
Pcnx2 T C 8: 125,877,567 H650R probably benign Het
Pcnx3 A T 19: 5,685,178 V540E possibly damaging Het
Pnpla5 C T 15: 84,118,618 G255R probably damaging Het
Pum3 T C 19: 27,416,799 Y357C probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rasa3 A T 8: 13,677,391 probably null Het
Rcor2 T A 19: 7,268,975 M5K possibly damaging Het
Rere A G 4: 150,508,875 T309A unknown Het
Ryr1 A T 7: 29,076,872 I2250N probably damaging Het
Sema6c T C 3: 95,168,030 V130A probably benign Het
Slc26a9 T A 1: 131,755,417 S200T probably damaging Het
Slc38a10 A G 11: 120,132,693 L299P possibly damaging Het
Smim10l1 G T 6: 133,107,885 V72L unknown Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svep1 T A 4: 58,118,145 Y859F possibly damaging Het
Svil C A 18: 5,056,098 Q324K possibly damaging Het
Tgfb1i1 A T 7: 128,252,877 D377V probably damaging Het
Tmed10 C A 12: 85,343,480 W203L probably damaging Het
Tmem51 T A 4: 142,037,745 M1L possibly damaging Het
Tmprss11e A G 5: 86,707,400 V382A probably benign Het
Tnfrsf13b G T 11: 61,147,524 R211L possibly damaging Het
Tns3 A G 11: 8,518,273 V317A probably damaging Het
Top3a G A 11: 60,740,537 P1000S possibly damaging Het
Traj32 A T 14: 54,186,130 I10F Het
Trav8-1 T A 14: 53,470,220 C106S probably damaging Het
Trbv2 A G 6: 41,047,721 I24V probably benign Het
Ubap2 A G 4: 41,209,351 probably null Het
Vmn2r97 T A 17: 18,940,210 C536S probably damaging Het
Zfp879 G T 11: 50,832,602 C542* probably null Het
Other mutations in Ppdpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ppdpf APN 2 181187894 splice site probably benign
IGL03238:Ppdpf APN 2 181187880 missense probably benign
IGL03240:Ppdpf APN 2 181187880 missense probably benign
IGL03384:Ppdpf APN 2 181187880 missense probably benign
R3917:Ppdpf UTSW 2 181187728 missense probably benign 0.19
R6148:Ppdpf UTSW 2 181187848 missense probably benign 0.01
R7134:Ppdpf UTSW 2 181187730 missense probably damaging 1.00
R7950:Ppdpf UTSW 2 181187857 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGAAACCTGGCACTGTC -3'
(R):5'- GAACGGGAGTGTGGATTTCC -3'

Sequencing Primer
(F):5'- TGACCAGGGCCCACATTCTG -3'
(R):5'- TTTCCCGAAAAAGAAGCTGGC -3'
Posted On2021-04-30