Incidental Mutation 'R0733:Abl1'
ID67085
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0733 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31778945 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 88 (Y88C)
Ref Sequence ENSEMBL: ENSMUSP00000117748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000123471] [ENSMUST00000124089] [ENSMUST00000135233] [ENSMUST00000142554]
Predicted Effect probably damaging
Transcript: ENSMUST00000028190
AA Change: Y93C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: Y93C

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075759
AA Change: Y112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: Y112C

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123471
SMART Domains Protein: ENSMUSP00000142297
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 64 3e-39 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000124089
AA Change: Y88C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117748
Gene: ENSMUSG00000026842
AA Change: Y88C

DomainStartEndE-ValueType
SH3 59 114 1.14e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135233
SMART Domains Protein: ENSMUSP00000141320
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 51 2e-28 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Meta Mutation Damage Score 0.3560 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
R7639:Abl1 UTSW 2 31779161 missense probably damaging 1.00
R7674:Abl1 UTSW 2 31689829 missense possibly damaging 0.91
R7781:Abl1 UTSW 2 31790697 missense probably damaging 1.00
R7802:Abl1 UTSW 2 31760426 missense probably benign
Z1176:Abl1 UTSW 2 31689827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTACACGTTTCCCCATGTTCC -3'
(R):5'- AAGAAGCTGCCGTTGATTCCGCTG -3'

Sequencing Primer
(F):5'- TGTTCCTACAGAAGACACCTG -3'
(R):5'- GCTGCTCAGCAGATACTCAG -3'
Posted On2013-09-03