Incidental Mutation 'R8790:Cfap57'
ID 670853
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118581914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 805 (Q805L)
Ref Sequence ENSEMBL: ENSMUSP00000071863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect possibly damaging
Transcript: ENSMUST00000071972
AA Change: Q805L

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: Q805L

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081921
AA Change: Q805L

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: Q805L

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,092,451 P68S possibly damaging Het
Abcb5 T A 12: 118,867,885 N1244I possibly damaging Het
Abcb9 A G 5: 124,077,241 I479T probably damaging Het
Abi3bp A T 16: 56,675,074 I920F probably damaging Het
Adcy6 T A 15: 98,599,000 T465S probably damaging Het
Ankrd12 A T 17: 65,983,158 I1760N possibly damaging Het
Aoah C T 13: 20,851,670 R140C probably benign Het
Bmp7 T A 2: 172,870,267 D388V probably benign Het
Bphl C T 13: 34,060,485 A195V probably benign Het
Cckar A G 5: 53,699,949 V373A probably damaging Het
Cd79b T G 11: 106,312,047 D243A possibly damaging Het
Cdc25a T A 9: 109,887,348 probably null Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Cluap1 T A 16: 3,917,923 probably benign Het
Cyp2b9 A G 7: 26,198,742 probably benign Het
D930020B18Rik G A 10: 121,667,663 G248S possibly damaging Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Dmkn G A 7: 30,764,024 S34N probably benign Het
Dnaaf2 T C 12: 69,197,294 D331G probably damaging Het
Dnah1 A T 14: 31,296,275 Y1429N possibly damaging Het
Dnajc5b T A 3: 19,546,817 L26Q probably damaging Het
Epb41l1 T G 2: 156,503,802 F242V possibly damaging Het
Esam A T 9: 37,531,631 I72F probably benign Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam98a A G 17: 75,547,689 F42L possibly damaging Het
Fras1 C T 5: 96,755,377 P3038S probably damaging Het
Gm32742 C A 9: 51,147,840 G1035C probably damaging Het
Irf5 T A 6: 29,535,027 probably benign Het
Jam2 T A 16: 84,809,371 I91K possibly damaging Het
Klhdc3 A G 17: 46,680,700 probably benign Het
Lgi1 C T 19: 38,300,848 S215F possibly damaging Het
Lrp1 G A 10: 127,539,077 T4504I probably damaging Het
Mafa T A 15: 75,747,375 H183L probably benign Het
Map2 T C 1: 66,438,838 V1773A probably damaging Het
Mesp1 G A 7: 79,793,077 R151* probably null Het
Mphosph9 T C 5: 124,315,673 D192G probably damaging Het
Mthfr C A 4: 148,055,534 D678E probably benign Het
Myo15 A C 11: 60,476,536 T41P possibly damaging Het
Myo15 G T 11: 60,487,221 R185L Het
Myom2 T G 8: 15,119,242 L1136W probably damaging Het
Naa30 A G 14: 49,180,751 D316G probably benign Het
Ngef T C 1: 87,477,597 Q697R probably benign Het
Nin T C 12: 70,021,019 R1945G Het
Obox8 A T 7: 14,332,983 Y45* probably null Het
Ocln C T 13: 100,506,219 V452I probably benign Het
Olfr1082 T C 2: 86,593,934 K298R possibly damaging Het
Olfr187 T C 16: 59,036,217 I173M possibly damaging Het
Olfr76 T C 19: 12,120,542 N57D probably damaging Het
Olfr967 T A 9: 39,750,908 I174K probably damaging Het
Oog3 T A 4: 144,159,140 D296V possibly damaging Het
Papln T C 12: 83,777,144 V499A probably benign Het
Paxip1 G T 5: 27,772,080 P328Q unknown Het
Pcnx2 T C 8: 125,877,567 H650R probably benign Het
Pcnx3 A T 19: 5,685,178 V540E possibly damaging Het
Pnpla5 C T 15: 84,118,618 G255R probably damaging Het
Ppdpf G T 2: 181,187,853 E34* probably null Het
Pum3 T C 19: 27,416,799 Y357C probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rasa3 A T 8: 13,677,391 probably null Het
Rcor2 T A 19: 7,268,975 M5K possibly damaging Het
Rere A G 4: 150,508,875 T309A unknown Het
Ryr1 A T 7: 29,076,872 I2250N probably damaging Het
Sema6c T C 3: 95,168,030 V130A probably benign Het
Slc26a9 T A 1: 131,755,417 S200T probably damaging Het
Slc38a10 A G 11: 120,132,693 L299P possibly damaging Het
Smim10l1 G T 6: 133,107,885 V72L unknown Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svep1 T A 4: 58,118,145 Y859F possibly damaging Het
Svil C A 18: 5,056,098 Q324K possibly damaging Het
Tgfb1i1 A T 7: 128,252,877 D377V probably damaging Het
Tmed10 C A 12: 85,343,480 W203L probably damaging Het
Tmem51 T A 4: 142,037,745 M1L possibly damaging Het
Tmprss11e A G 5: 86,707,400 V382A probably benign Het
Tnfrsf13b G T 11: 61,147,524 R211L possibly damaging Het
Tns3 A G 11: 8,518,273 V317A probably damaging Het
Top3a G A 11: 60,740,537 P1000S possibly damaging Het
Traj32 A T 14: 54,186,130 I10F Het
Trav8-1 T A 14: 53,470,220 C106S probably damaging Het
Trbv2 A G 6: 41,047,721 I24V probably benign Het
Ubap2 A G 4: 41,209,351 probably null Het
Vmn2r97 T A 17: 18,940,210 C536S probably damaging Het
Zfp879 G T 11: 50,832,602 C542* probably null Het
Znfx1 C T 2: 167,050,580 probably benign Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7642:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACCAATTGAGCCGCTCTAATTG -3'
(R):5'- CAGAGGCAGTCGTTGGAGTTAG -3'

Sequencing Primer
(F):5'- GAGCCGCTCTAATTGCTCCAC -3'
(R):5'- AGTTAGGCGGGCCTTGAAC -3'
Posted On 2021-04-30