Incidental Mutation 'R8790:Myom2'
ID 670872
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 15057653-15133541 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15119242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 1136 (L1136W)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect probably damaging
Transcript: ENSMUST00000033842
AA Change: L1136W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: L1136W

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,092,451 P68S possibly damaging Het
Abcb5 T A 12: 118,867,885 N1244I possibly damaging Het
Abcb9 A G 5: 124,077,241 I479T probably damaging Het
Abi3bp A T 16: 56,675,074 I920F probably damaging Het
Adcy6 T A 15: 98,599,000 T465S probably damaging Het
Ankrd12 A T 17: 65,983,158 I1760N possibly damaging Het
Aoah C T 13: 20,851,670 R140C probably benign Het
Bmp7 T A 2: 172,870,267 D388V probably benign Het
Bphl C T 13: 34,060,485 A195V probably benign Het
Cckar A G 5: 53,699,949 V373A probably damaging Het
Cd79b T G 11: 106,312,047 D243A possibly damaging Het
Cdc25a T A 9: 109,887,348 probably null Het
Cfap57 T A 4: 118,581,914 Q805L possibly damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Cluap1 T A 16: 3,917,923 probably benign Het
Cyp2b9 A G 7: 26,198,742 probably benign Het
D930020B18Rik G A 10: 121,667,663 G248S possibly damaging Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Dmkn G A 7: 30,764,024 S34N probably benign Het
Dnaaf2 T C 12: 69,197,294 D331G probably damaging Het
Dnah1 A T 14: 31,296,275 Y1429N possibly damaging Het
Dnajc5b T A 3: 19,546,817 L26Q probably damaging Het
Epb41l1 T G 2: 156,503,802 F242V possibly damaging Het
Esam A T 9: 37,531,631 I72F probably benign Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam98a A G 17: 75,547,689 F42L possibly damaging Het
Fras1 C T 5: 96,755,377 P3038S probably damaging Het
Gm32742 C A 9: 51,147,840 G1035C probably damaging Het
Irf5 T A 6: 29,535,027 probably benign Het
Jam2 T A 16: 84,809,371 I91K possibly damaging Het
Klhdc3 A G 17: 46,680,700 probably benign Het
Lgi1 C T 19: 38,300,848 S215F possibly damaging Het
Lrp1 G A 10: 127,539,077 T4504I probably damaging Het
Mafa T A 15: 75,747,375 H183L probably benign Het
Map2 T C 1: 66,438,838 V1773A probably damaging Het
Mesp1 G A 7: 79,793,077 R151* probably null Het
Mphosph9 T C 5: 124,315,673 D192G probably damaging Het
Mthfr C A 4: 148,055,534 D678E probably benign Het
Myo15 A C 11: 60,476,536 T41P possibly damaging Het
Myo15 G T 11: 60,487,221 R185L Het
Naa30 A G 14: 49,180,751 D316G probably benign Het
Ngef T C 1: 87,477,597 Q697R probably benign Het
Nin T C 12: 70,021,019 R1945G Het
Obox8 A T 7: 14,332,983 Y45* probably null Het
Ocln C T 13: 100,506,219 V452I probably benign Het
Olfr1082 T C 2: 86,593,934 K298R possibly damaging Het
Olfr187 T C 16: 59,036,217 I173M possibly damaging Het
Olfr76 T C 19: 12,120,542 N57D probably damaging Het
Olfr967 T A 9: 39,750,908 I174K probably damaging Het
Oog3 T A 4: 144,159,140 D296V possibly damaging Het
Papln T C 12: 83,777,144 V499A probably benign Het
Paxip1 G T 5: 27,772,080 P328Q unknown Het
Pcnx2 T C 8: 125,877,567 H650R probably benign Het
Pcnx3 A T 19: 5,685,178 V540E possibly damaging Het
Pnpla5 C T 15: 84,118,618 G255R probably damaging Het
Ppdpf G T 2: 181,187,853 E34* probably null Het
Pum3 T C 19: 27,416,799 Y357C probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rasa3 A T 8: 13,677,391 probably null Het
Rcor2 T A 19: 7,268,975 M5K possibly damaging Het
Rere A G 4: 150,508,875 T309A unknown Het
Ryr1 A T 7: 29,076,872 I2250N probably damaging Het
Sema6c T C 3: 95,168,030 V130A probably benign Het
Slc26a9 T A 1: 131,755,417 S200T probably damaging Het
Slc38a10 A G 11: 120,132,693 L299P possibly damaging Het
Smim10l1 G T 6: 133,107,885 V72L unknown Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svep1 T A 4: 58,118,145 Y859F possibly damaging Het
Svil C A 18: 5,056,098 Q324K possibly damaging Het
Tgfb1i1 A T 7: 128,252,877 D377V probably damaging Het
Tmed10 C A 12: 85,343,480 W203L probably damaging Het
Tmem51 T A 4: 142,037,745 M1L possibly damaging Het
Tmprss11e A G 5: 86,707,400 V382A probably benign Het
Tnfrsf13b G T 11: 61,147,524 R211L possibly damaging Het
Tns3 A G 11: 8,518,273 V317A probably damaging Het
Top3a G A 11: 60,740,537 P1000S possibly damaging Het
Traj32 A T 14: 54,186,130 I10F Het
Trav8-1 T A 14: 53,470,220 C106S probably damaging Het
Trbv2 A G 6: 41,047,721 I24V probably benign Het
Ubap2 A G 4: 41,209,351 probably null Het
Vmn2r97 T A 17: 18,940,210 C536S probably damaging Het
Zfp879 G T 11: 50,832,602 C542* probably null Het
Znfx1 C T 2: 167,050,580 probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
yomama UTSW 8 15132895 missense probably benign 0.10
yoyoma UTSW 8 15132667 missense probably damaging 0.99
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 splice site probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
R8514:Myom2 UTSW 8 15125153 missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15114254 missense probably benign 0.01
R8824:Myom2 UTSW 8 15114169 missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15102589 nonsense probably null
R9024:Myom2 UTSW 8 15063936 missense probably damaging 1.00
R9129:Myom2 UTSW 8 15104068 missense probably damaging 1.00
R9224:Myom2 UTSW 8 15128804 missense possibly damaging 0.89
R9237:Myom2 UTSW 8 15102591 missense possibly damaging 0.85
R9321:Myom2 UTSW 8 15122464 missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15084633 missense probably damaging 0.97
R9343:Myom2 UTSW 8 15084633 missense probably damaging 0.97
R9375:Myom2 UTSW 8 15099210 missense probably damaging 1.00
R9455:Myom2 UTSW 8 15106293 missense probably benign 0.31
R9563:Myom2 UTSW 8 15108399 nonsense probably null
R9565:Myom2 UTSW 8 15108399 nonsense probably null
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGGCCAACTTCAGGACTATGAG -3'
(R):5'- GGTACTTACCATCTAAGTTCCGC -3'

Sequencing Primer
(F):5'- TCAGGACTATGAGAAGTACCTTAGC -3'
(R):5'- CAGGGTTCACGAGACCCTG -3'
Posted On 2021-04-30