Incidental Mutation 'R0733:Snx27'
ID67088
Institutional Source Beutler Lab
Gene Symbol Snx27
Ensembl Gene ENSMUSG00000028136
Gene Namesorting nexin family member 27
SynonymsESTM47, 5730552M22Rik
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0733 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94497544-94582716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94562013 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 7 (L7P)
Ref Sequence ENSEMBL: ENSMUSP00000143066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029783] [ENSMUST00000107283] [ENSMUST00000198426] [ENSMUST00000199462] [ENSMUST00000200642]
Predicted Effect probably benign
Transcript: ENSMUST00000029783
SMART Domains Protein: ENSMUSP00000029783
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107283
SMART Domains Protein: ENSMUSP00000102904
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198426
SMART Domains Protein: ENSMUSP00000143525
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
PX 1 93 5.11e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199462
SMART Domains Protein: ENSMUSP00000143378
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDB:3QE1|A 39 58 9e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200642
AA Change: L7P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143066
Gene: ENSMUSG00000028136
AA Change: L7P

DomainStartEndE-ValueType
PDB:3QGL|E 12 42 3e-12 PDB
PX 63 172 7.5e-21 SMART
Pfam:RA 180 269 5.3e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family, a diverse group of cytoplasmic and membrane-associated proteins involved in endocytosis of plasma membrane receptors and protein trafficking through these compartments. All members of this protein family contain a phosphoinositide binding domain (PX domain). A highly similar protein in mouse is responsible for the specific recruitment of an isoform of serotonin 5-hydroxytryptamine 4 receptor into early endosomes, suggesting the analogous role for the human protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal and postnatal lethality, decreased organ size, slow postnatal weight gain, and decreased endocytosis of Grin2c. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Snx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Snx27 APN 3 94561972 missense probably damaging 1.00
IGL01061:Snx27 APN 3 94528980 splice site probably benign
IGL01598:Snx27 APN 3 94561843 missense probably damaging 1.00
IGL02276:Snx27 APN 3 94531379 missense probably damaging 1.00
IGL02558:Snx27 APN 3 94502881 missense probably damaging 0.99
IGL02748:Snx27 APN 3 94503565 missense probably benign 0.04
IGL02817:Snx27 APN 3 94503463 missense probably damaging 1.00
IGL02965:Snx27 APN 3 94582426 missense probably damaging 0.99
R1241:Snx27 UTSW 3 94520233 missense probably benign 0.18
R1882:Snx27 UTSW 3 94519109 missense probably damaging 0.97
R2517:Snx27 UTSW 3 94531234 missense probably damaging 1.00
R3850:Snx27 UTSW 3 94520235 missense probably benign 0.00
R3964:Snx27 UTSW 3 94531306 missense probably damaging 1.00
R4035:Snx27 UTSW 3 94524244 missense probably damaging 0.99
R4172:Snx27 UTSW 3 94503487 missense probably benign 0.00
R4424:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4425:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4548:Snx27 UTSW 3 94526439 intron probably benign
R4820:Snx27 UTSW 3 94520211 missense probably damaging 1.00
R5114:Snx27 UTSW 3 94524244 missense probably damaging 1.00
R5672:Snx27 UTSW 3 94502850 splice site probably null
R5877:Snx27 UTSW 3 94502963 missense probably damaging 1.00
R7138:Snx27 UTSW 3 94528940 missense probably benign 0.04
R7284:Snx27 UTSW 3 94524191 missense probably damaging 0.97
R7403:Snx27 UTSW 3 94528926 missense probably damaging 1.00
R7593:Snx27 UTSW 3 94502965 missense possibly damaging 0.83
R7827:Snx27 UTSW 3 94519059 missense probably benign 0.11
X0057:Snx27 UTSW 3 94524274 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GATTGTCCCAAGGAGTCGTCACTG -3'
(R):5'- TTCCCACATGCTTTCCTGAATCGAG -3'

Sequencing Primer
(F):5'- GGAGGTACAGACAACACTGT -3'
(R):5'- AATCGAGCAGTGTGTAGCATTC -3'
Posted On2013-09-03