Mutagenetix > Incidental Mutation

Incidental Mutation 'R8790:Tns3'

670882

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.448) question?

Stock #

R8790 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8518273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 317 (V317A)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000020695
AA Change: V317A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: V317A

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	G	A	10: 79,092,451	P68S	possibly damaging	Het
Abcb5	T	A	12: 118,867,885	N1244I	possibly damaging	Het
Abcb9	A	G	5: 124,077,241	I479T	probably damaging	Het
Abi3bp	A	T	16: 56,675,074	I920F	probably damaging	Het
Adcy6	T	A	15: 98,599,000	T465S	probably damaging	Het
Ankrd12	A	T	17: 65,983,158	I1760N	possibly damaging	Het
Aoah	C	T	13: 20,851,670	R140C	probably benign	Het
Bmp7	T	A	2: 172,870,267	D388V	probably benign	Het
Bphl	C	T	13: 34,060,485	A195V	probably benign	Het
Cckar	A	G	5: 53,699,949	V373A	probably damaging	Het
Cd79b	T	G	11: 106,312,047	D243A	possibly damaging	Het
Cdc25a	T	A	9: 109,887,348		probably null	Het
Cfap57	T	A	4: 118,581,914	Q805L	possibly damaging	Het
Ckap2l	A	T	2: 129,269,252	M675K	possibly damaging	Het
Cluap1	T	A	16: 3,917,923		probably benign	Het
Cyp2b9	A	G	7: 26,198,742		probably benign	Het
D930020B18Rik	G	A	10: 121,667,663	G248S	possibly damaging	Het
Ddx1	A	T	12: 13,223,992	I570N	probably damaging	Het
Dmkn	G	A	7: 30,764,024	S34N	probably benign	Het
Dnaaf2	T	C	12: 69,197,294	D331G	probably damaging	Het
Dnah1	A	T	14: 31,296,275	Y1429N	possibly damaging	Het
Dnajc5b	T	A	3: 19,546,817	L26Q	probably damaging	Het
Epb41l1	T	G	2: 156,503,802	F242V	possibly damaging	Het
Esam	A	T	9: 37,531,631	I72F	probably benign	Het
Fam110a	C	T	2: 151,970,418	R144H	probably damaging	Het
Fam186a	T	C	15: 99,943,143	D1740G	possibly damaging	Het
Fam98a	A	G	17: 75,547,689	F42L	possibly damaging	Het
Fras1	C	T	5: 96,755,377	P3038S	probably damaging	Het
Gm32742	C	A	9: 51,147,840	G1035C	probably damaging	Het
Irf5	T	A	6: 29,535,027		probably benign	Het
Jam2	T	A	16: 84,809,371	I91K	possibly damaging	Het
Klhdc3	A	G	17: 46,680,700		probably benign	Het
Lgi1	C	T	19: 38,300,848	S215F	possibly damaging	Het
Lrp1	G	A	10: 127,539,077	T4504I	probably damaging	Het
Mafa	T	A	15: 75,747,375	H183L	probably benign	Het
Map2	T	C	1: 66,438,838	V1773A	probably damaging	Het
Mesp1	G	A	7: 79,793,077	R151*	probably null	Het
Mphosph9	T	C	5: 124,315,673	D192G	probably damaging	Het
Mthfr	C	A	4: 148,055,534	D678E	probably benign	Het
Myo15	A	C	11: 60,476,536	T41P	possibly damaging	Het
Myo15	G	T	11: 60,487,221	R185L		Het
Myom2	T	G	8: 15,119,242	L1136W	probably damaging	Het
Naa30	A	G	14: 49,180,751	D316G	probably benign	Het
Ngef	T	C	1: 87,477,597	Q697R	probably benign	Het
Nin	T	C	12: 70,021,019	R1945G		Het
Obox8	A	T	7: 14,332,983	Y45*	probably null	Het
Ocln	C	T	13: 100,506,219	V452I	probably benign	Het
Olfr1082	T	C	2: 86,593,934	K298R	possibly damaging	Het
Olfr187	T	C	16: 59,036,217	I173M	possibly damaging	Het
Olfr76	T	C	19: 12,120,542	N57D	probably damaging	Het
Olfr967	T	A	9: 39,750,908	I174K	probably damaging	Het
Oog3	T	A	4: 144,159,140	D296V	possibly damaging	Het
Papln	T	C	12: 83,777,144	V499A	probably benign	Het
Paxip1	G	T	5: 27,772,080	P328Q	unknown	Het
Pcnx2	T	C	8: 125,877,567	H650R	probably benign	Het
Pcnx3	A	T	19: 5,685,178	V540E	possibly damaging	Het
Pnpla5	C	T	15: 84,118,618	G255R	probably damaging	Het
Ppdpf	G	T	2: 181,187,853	E34*	probably null	Het
Pum3	T	C	19: 27,416,799	Y357C	probably damaging	Het
R3hdm2	T	G	10: 127,457,652	S142A	probably damaging	Het
Rasa3	A	T	8: 13,677,391		probably null	Het
Rcor2	T	A	19: 7,268,975	M5K	possibly damaging	Het
Rere	A	G	4: 150,508,875	T309A	unknown	Het
Ryr1	A	T	7: 29,076,872	I2250N	probably damaging	Het
Sema6c	T	C	3: 95,168,030	V130A	probably benign	Het
Slc26a9	T	A	1: 131,755,417	S200T	probably damaging	Het
Slc38a10	A	G	11: 120,132,693	L299P	possibly damaging	Het
Smim10l1	G	T	6: 133,107,885	V72L	unknown	Het
Sptbn2	C	A	19: 4,732,024	F430L	probably damaging	Het
Svep1	T	A	4: 58,118,145	Y859F	possibly damaging	Het
Svil	C	A	18: 5,056,098	Q324K	possibly damaging	Het
Tgfb1i1	A	T	7: 128,252,877	D377V	probably damaging	Het
Tmed10	C	A	12: 85,343,480	W203L	probably damaging	Het
Tmem51	T	A	4: 142,037,745	M1L	possibly damaging	Het
Tmprss11e	A	G	5: 86,707,400	V382A	probably benign	Het
Tnfrsf13b	G	T	11: 61,147,524	R211L	possibly damaging	Het
Top3a	G	A	11: 60,740,537	P1000S	possibly damaging	Het
Traj32	A	T	14: 54,186,130	I10F		Het
Trav8-1	T	A	14: 53,470,220	C106S	probably damaging	Het
Trbv2	A	G	6: 41,047,721	I24V	probably benign	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Vmn2r97	T	A	17: 18,940,210	C536S	probably damaging	Het
Zfp879	G	T	11: 50,832,602	C542*	probably null	Het
Znfx1	C	T	2: 167,050,580		probably benign	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9374:Tns3	UTSW	11	8492606	missense	probably damaging	1.00
R9476:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAAGTGCCTTCAAAACCG -3'
(R):5'- GGCCTCAACCTTCCCAATACTG -3'

Sequencing Primer
(F):5'- TGCCTTCAAAACCGGCAGTG -3'
(R):5'- CCAATACTGAAATTGGCTACATGGTC -3'

Posted On

2021-04-30