Incidental Mutation 'R8790:Tns3'
ID 670882
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms TEM6, F830010I22Rik, Tens1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 8431652-8664535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8518273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000020695
AA Change: V317A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: V317A

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,092,451 P68S possibly damaging Het
Abcb5 T A 12: 118,867,885 N1244I possibly damaging Het
Abcb9 A G 5: 124,077,241 I479T probably damaging Het
Abi3bp A T 16: 56,675,074 I920F probably damaging Het
Adcy6 T A 15: 98,599,000 T465S probably damaging Het
Ankrd12 A T 17: 65,983,158 I1760N possibly damaging Het
Aoah C T 13: 20,851,670 R140C probably benign Het
Bmp7 T A 2: 172,870,267 D388V probably benign Het
Bphl C T 13: 34,060,485 A195V probably benign Het
Cckar A G 5: 53,699,949 V373A probably damaging Het
Cd79b T G 11: 106,312,047 D243A possibly damaging Het
Cdc25a T A 9: 109,887,348 probably null Het
Cfap57 T A 4: 118,581,914 Q805L possibly damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Cluap1 T A 16: 3,917,923 probably benign Het
Cyp2b9 A G 7: 26,198,742 probably benign Het
D930020B18Rik G A 10: 121,667,663 G248S possibly damaging Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Dmkn G A 7: 30,764,024 S34N probably benign Het
Dnaaf2 T C 12: 69,197,294 D331G probably damaging Het
Dnah1 A T 14: 31,296,275 Y1429N possibly damaging Het
Dnajc5b T A 3: 19,546,817 L26Q probably damaging Het
Epb41l1 T G 2: 156,503,802 F242V possibly damaging Het
Esam A T 9: 37,531,631 I72F probably benign Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam98a A G 17: 75,547,689 F42L possibly damaging Het
Fras1 C T 5: 96,755,377 P3038S probably damaging Het
Gm32742 C A 9: 51,147,840 G1035C probably damaging Het
Irf5 T A 6: 29,535,027 probably benign Het
Jam2 T A 16: 84,809,371 I91K possibly damaging Het
Klhdc3 A G 17: 46,680,700 probably benign Het
Lgi1 C T 19: 38,300,848 S215F possibly damaging Het
Lrp1 G A 10: 127,539,077 T4504I probably damaging Het
Mafa T A 15: 75,747,375 H183L probably benign Het
Map2 T C 1: 66,438,838 V1773A probably damaging Het
Mesp1 G A 7: 79,793,077 R151* probably null Het
Mphosph9 T C 5: 124,315,673 D192G probably damaging Het
Mthfr C A 4: 148,055,534 D678E probably benign Het
Myo15 A C 11: 60,476,536 T41P possibly damaging Het
Myo15 G T 11: 60,487,221 R185L Het
Myom2 T G 8: 15,119,242 L1136W probably damaging Het
Naa30 A G 14: 49,180,751 D316G probably benign Het
Ngef T C 1: 87,477,597 Q697R probably benign Het
Nin T C 12: 70,021,019 R1945G Het
Obox8 A T 7: 14,332,983 Y45* probably null Het
Ocln C T 13: 100,506,219 V452I probably benign Het
Olfr1082 T C 2: 86,593,934 K298R possibly damaging Het
Olfr187 T C 16: 59,036,217 I173M possibly damaging Het
Olfr76 T C 19: 12,120,542 N57D probably damaging Het
Olfr967 T A 9: 39,750,908 I174K probably damaging Het
Oog3 T A 4: 144,159,140 D296V possibly damaging Het
Papln T C 12: 83,777,144 V499A probably benign Het
Paxip1 G T 5: 27,772,080 P328Q unknown Het
Pcnx2 T C 8: 125,877,567 H650R probably benign Het
Pcnx3 A T 19: 5,685,178 V540E possibly damaging Het
Pnpla5 C T 15: 84,118,618 G255R probably damaging Het
Ppdpf G T 2: 181,187,853 E34* probably null Het
Pum3 T C 19: 27,416,799 Y357C probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rasa3 A T 8: 13,677,391 probably null Het
Rcor2 T A 19: 7,268,975 M5K possibly damaging Het
Rere A G 4: 150,508,875 T309A unknown Het
Ryr1 A T 7: 29,076,872 I2250N probably damaging Het
Sema6c T C 3: 95,168,030 V130A probably benign Het
Slc26a9 T A 1: 131,755,417 S200T probably damaging Het
Slc38a10 A G 11: 120,132,693 L299P possibly damaging Het
Smim10l1 G T 6: 133,107,885 V72L unknown Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svep1 T A 4: 58,118,145 Y859F possibly damaging Het
Svil C A 18: 5,056,098 Q324K possibly damaging Het
Tgfb1i1 A T 7: 128,252,877 D377V probably damaging Het
Tmed10 C A 12: 85,343,480 W203L probably damaging Het
Tmem51 T A 4: 142,037,745 M1L possibly damaging Het
Tmprss11e A G 5: 86,707,400 V382A probably benign Het
Tnfrsf13b G T 11: 61,147,524 R211L possibly damaging Het
Top3a G A 11: 60,740,537 P1000S possibly damaging Het
Traj32 A T 14: 54,186,130 I10F Het
Trav8-1 T A 14: 53,470,220 C106S probably damaging Het
Trbv2 A G 6: 41,047,721 I24V probably benign Het
Ubap2 A G 4: 41,209,351 probably null Het
Vmn2r97 T A 17: 18,940,210 C536S probably damaging Het
Zfp879 G T 11: 50,832,602 C542* probably null Het
Znfx1 C T 2: 167,050,580 probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
R8518:Tns3 UTSW 11 8492971 missense probably damaging 0.96
R8523:Tns3 UTSW 11 8448779 missense probably damaging 1.00
R9228:Tns3 UTSW 11 8450094 missense probably damaging 1.00
R9374:Tns3 UTSW 11 8492606 missense probably damaging 1.00
R9476:Tns3 UTSW 11 8445702 missense probably damaging 0.99
R9510:Tns3 UTSW 11 8445702 missense probably damaging 0.99
R9594:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8451142 missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGTGCCTTCAAAACCG -3'
(R):5'- GGCCTCAACCTTCCCAATACTG -3'

Sequencing Primer
(F):5'- TGCCTTCAAAACCGGCAGTG -3'
(R):5'- CCAATACTGAAATTGGCTACATGGTC -3'
Posted On 2021-04-30