Incidental Mutation 'R8790:Tns3'
ID 670882
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission 068634-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8468273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000020695
AA Change: V317A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: V317A

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,928,285 (GRCm39) P68S possibly damaging Het
Abcb5 T A 12: 118,831,620 (GRCm39) N1244I possibly damaging Het
Abcb9 A G 5: 124,215,304 (GRCm39) I479T probably damaging Het
Abi3bp A T 16: 56,495,437 (GRCm39) I920F probably damaging Het
Adcy6 T A 15: 98,496,881 (GRCm39) T465S probably damaging Het
Ankrd12 A T 17: 66,290,153 (GRCm39) I1760N possibly damaging Het
Aoah C T 13: 21,035,840 (GRCm39) R140C probably benign Het
Bmp7 T A 2: 172,712,060 (GRCm39) D388V probably benign Het
Bphl C T 13: 34,244,468 (GRCm39) A195V probably benign Het
Cckar A G 5: 53,857,291 (GRCm39) V373A probably damaging Het
Cd79b T G 11: 106,202,873 (GRCm39) D243A possibly damaging Het
Cdc25a T A 9: 109,716,416 (GRCm39) probably null Het
Cfap57 T A 4: 118,439,111 (GRCm39) Q805L possibly damaging Het
Ckap2l A T 2: 129,111,172 (GRCm39) M675K possibly damaging Het
Cluap1 T A 16: 3,735,787 (GRCm39) probably benign Het
Cyp2b9 A G 7: 25,898,167 (GRCm39) probably benign Het
D930020B18Rik G A 10: 121,503,568 (GRCm39) G248S possibly damaging Het
Ddx1 A T 12: 13,273,993 (GRCm39) I570N probably damaging Het
Dmkn G A 7: 30,463,449 (GRCm39) S34N probably benign Het
Dnaaf2 T C 12: 69,244,068 (GRCm39) D331G probably damaging Het
Dnah1 A T 14: 31,018,232 (GRCm39) Y1429N possibly damaging Het
Dnajc5b T A 3: 19,600,981 (GRCm39) L26Q probably damaging Het
Epb41l1 T G 2: 156,345,722 (GRCm39) F242V possibly damaging Het
Esam A T 9: 37,442,927 (GRCm39) I72F probably benign Het
Fam110a C T 2: 151,812,338 (GRCm39) R144H probably damaging Het
Fam186a T C 15: 99,841,024 (GRCm39) D1740G possibly damaging Het
Fam98a A G 17: 75,854,684 (GRCm39) F42L possibly damaging Het
Fras1 C T 5: 96,903,236 (GRCm39) P3038S probably damaging Het
Gm32742 C A 9: 51,059,140 (GRCm39) G1035C probably damaging Het
Irf5 T A 6: 29,535,026 (GRCm39) probably benign Het
Jam2 T A 16: 84,606,259 (GRCm39) I91K possibly damaging Het
Klhdc3 A G 17: 46,991,626 (GRCm39) probably benign Het
Lgi1 C T 19: 38,289,296 (GRCm39) S215F possibly damaging Het
Lrp1 G A 10: 127,374,946 (GRCm39) T4504I probably damaging Het
Mafa T A 15: 75,619,224 (GRCm39) H183L probably benign Het
Map2 T C 1: 66,477,997 (GRCm39) V1773A probably damaging Het
Mesp1 G A 7: 79,442,825 (GRCm39) R151* probably null Het
Mphosph9 T C 5: 124,453,736 (GRCm39) D192G probably damaging Het
Mthfr C A 4: 148,139,991 (GRCm39) D678E probably benign Het
Myo15a A C 11: 60,367,362 (GRCm39) T41P possibly damaging Het
Myo15a G T 11: 60,378,047 (GRCm39) R185L Het
Myom2 T G 8: 15,169,242 (GRCm39) L1136W probably damaging Het
Naa30 A G 14: 49,418,208 (GRCm39) D316G probably benign Het
Ngef T C 1: 87,405,319 (GRCm39) Q697R probably benign Het
Nin T C 12: 70,067,793 (GRCm39) R1945G Het
Obox8 A T 7: 14,066,908 (GRCm39) Y45* probably null Het
Ocln C T 13: 100,642,727 (GRCm39) V452I probably benign Het
Oog3 T A 4: 143,885,710 (GRCm39) D296V possibly damaging Het
Or5a1 T C 19: 12,097,906 (GRCm39) N57D probably damaging Het
Or5h19 T C 16: 58,856,580 (GRCm39) I173M possibly damaging Het
Or8g4 T A 9: 39,662,204 (GRCm39) I174K probably damaging Het
Or8k35 T C 2: 86,424,278 (GRCm39) K298R possibly damaging Het
Papln T C 12: 83,823,918 (GRCm39) V499A probably benign Het
Paxip1 G T 5: 27,977,078 (GRCm39) P328Q unknown Het
Pcnx2 T C 8: 126,604,306 (GRCm39) H650R probably benign Het
Pcnx3 A T 19: 5,735,206 (GRCm39) V540E possibly damaging Het
Pnpla5 C T 15: 84,002,819 (GRCm39) G255R probably damaging Het
Ppdpf G T 2: 180,829,646 (GRCm39) E34* probably null Het
Pum3 T C 19: 27,394,199 (GRCm39) Y357C probably damaging Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rasa3 A T 8: 13,727,391 (GRCm39) probably null Het
Rcor2 T A 19: 7,246,340 (GRCm39) M5K possibly damaging Het
Rere A G 4: 150,593,332 (GRCm39) T309A unknown Het
Ryr1 A T 7: 28,776,297 (GRCm39) I2250N probably damaging Het
Sema6c T C 3: 95,075,341 (GRCm39) V130A probably benign Het
Slc26a9 T A 1: 131,683,155 (GRCm39) S200T probably damaging Het
Slc38a10 A G 11: 120,023,519 (GRCm39) L299P possibly damaging Het
Smim10l1 G T 6: 133,084,848 (GRCm39) V72L unknown Het
Sptbn2 C A 19: 4,782,052 (GRCm39) F430L probably damaging Het
Svep1 T A 4: 58,118,145 (GRCm39) Y859F possibly damaging Het
Svil C A 18: 5,056,098 (GRCm39) Q324K possibly damaging Het
Tgfb1i1 A T 7: 127,852,049 (GRCm39) D377V probably damaging Het
Tmed10 C A 12: 85,390,254 (GRCm39) W203L probably damaging Het
Tmem51 T A 4: 141,765,056 (GRCm39) M1L possibly damaging Het
Tmprss11e A G 5: 86,855,259 (GRCm39) V382A probably benign Het
Tnfrsf13b G T 11: 61,038,350 (GRCm39) R211L possibly damaging Het
Top3a G A 11: 60,631,363 (GRCm39) P1000S possibly damaging Het
Traj32 A T 14: 54,423,587 (GRCm39) I10F Het
Trav8-1 T A 14: 53,707,677 (GRCm39) C106S probably damaging Het
Trbv2 A G 6: 41,024,655 (GRCm39) I24V probably benign Het
Ubap2 A G 4: 41,209,351 (GRCm39) probably null Het
Vmn2r97 T A 17: 19,160,472 (GRCm39) C536S probably damaging Het
Zfp879 G T 11: 50,723,429 (GRCm39) C542* probably null Het
Znfx1 C T 2: 166,892,500 (GRCm39) probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3765:Tns3 UTSW 11 8,401,133 (GRCm39) missense probably benign 0.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5749:Tns3 UTSW 11 8,401,177 (GRCm39) missense probably benign 0.01
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6025:Tns3 UTSW 11 8,442,578 (GRCm39) missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7576:Tns3 UTSW 11 8,491,192 (GRCm39) missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGTGCCTTCAAAACCG -3'
(R):5'- GGCCTCAACCTTCCCAATACTG -3'

Sequencing Primer
(F):5'- TGCCTTCAAAACCGGCAGTG -3'
(R):5'- CCAATACTGAAATTGGCTACATGGTC -3'
Posted On 2021-04-30