Incidental Mutation 'R8790:Myo15a'
ID 670885
Institutional Source Beutler Lab
Gene Symbol Myo15a
Ensembl Gene ENSMUSG00000042678
Gene Name myosin XVA
Synonyms Myo15
MMRRC Submission 068634-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 60360165-60419195 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 60378047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 185 (R185L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071880
AA Change: R1354L

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: R1354L

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081823
AA Change: R167L

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: R167L

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094135
AA Change: R1354L

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: R1354L

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: R185L

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,928,285 (GRCm39) P68S possibly damaging Het
Abcb5 T A 12: 118,831,620 (GRCm39) N1244I possibly damaging Het
Abcb9 A G 5: 124,215,304 (GRCm39) I479T probably damaging Het
Abi3bp A T 16: 56,495,437 (GRCm39) I920F probably damaging Het
Adcy6 T A 15: 98,496,881 (GRCm39) T465S probably damaging Het
Ankrd12 A T 17: 66,290,153 (GRCm39) I1760N possibly damaging Het
Aoah C T 13: 21,035,840 (GRCm39) R140C probably benign Het
Bmp7 T A 2: 172,712,060 (GRCm39) D388V probably benign Het
Bphl C T 13: 34,244,468 (GRCm39) A195V probably benign Het
Cckar A G 5: 53,857,291 (GRCm39) V373A probably damaging Het
Cd79b T G 11: 106,202,873 (GRCm39) D243A possibly damaging Het
Cdc25a T A 9: 109,716,416 (GRCm39) probably null Het
Cfap57 T A 4: 118,439,111 (GRCm39) Q805L possibly damaging Het
Ckap2l A T 2: 129,111,172 (GRCm39) M675K possibly damaging Het
Cluap1 T A 16: 3,735,787 (GRCm39) probably benign Het
Cyp2b9 A G 7: 25,898,167 (GRCm39) probably benign Het
D930020B18Rik G A 10: 121,503,568 (GRCm39) G248S possibly damaging Het
Ddx1 A T 12: 13,273,993 (GRCm39) I570N probably damaging Het
Dmkn G A 7: 30,463,449 (GRCm39) S34N probably benign Het
Dnaaf2 T C 12: 69,244,068 (GRCm39) D331G probably damaging Het
Dnah1 A T 14: 31,018,232 (GRCm39) Y1429N possibly damaging Het
Dnajc5b T A 3: 19,600,981 (GRCm39) L26Q probably damaging Het
Epb41l1 T G 2: 156,345,722 (GRCm39) F242V possibly damaging Het
Esam A T 9: 37,442,927 (GRCm39) I72F probably benign Het
Fam110a C T 2: 151,812,338 (GRCm39) R144H probably damaging Het
Fam186a T C 15: 99,841,024 (GRCm39) D1740G possibly damaging Het
Fam98a A G 17: 75,854,684 (GRCm39) F42L possibly damaging Het
Fras1 C T 5: 96,903,236 (GRCm39) P3038S probably damaging Het
Gm32742 C A 9: 51,059,140 (GRCm39) G1035C probably damaging Het
Irf5 T A 6: 29,535,026 (GRCm39) probably benign Het
Jam2 T A 16: 84,606,259 (GRCm39) I91K possibly damaging Het
Klhdc3 A G 17: 46,991,626 (GRCm39) probably benign Het
Lgi1 C T 19: 38,289,296 (GRCm39) S215F possibly damaging Het
Lrp1 G A 10: 127,374,946 (GRCm39) T4504I probably damaging Het
Mafa T A 15: 75,619,224 (GRCm39) H183L probably benign Het
Map2 T C 1: 66,477,997 (GRCm39) V1773A probably damaging Het
Mesp1 G A 7: 79,442,825 (GRCm39) R151* probably null Het
Mphosph9 T C 5: 124,453,736 (GRCm39) D192G probably damaging Het
Mthfr C A 4: 148,139,991 (GRCm39) D678E probably benign Het
Myom2 T G 8: 15,169,242 (GRCm39) L1136W probably damaging Het
Naa30 A G 14: 49,418,208 (GRCm39) D316G probably benign Het
Ngef T C 1: 87,405,319 (GRCm39) Q697R probably benign Het
Nin T C 12: 70,067,793 (GRCm39) R1945G Het
Obox8 A T 7: 14,066,908 (GRCm39) Y45* probably null Het
Ocln C T 13: 100,642,727 (GRCm39) V452I probably benign Het
Oog3 T A 4: 143,885,710 (GRCm39) D296V possibly damaging Het
Or5a1 T C 19: 12,097,906 (GRCm39) N57D probably damaging Het
Or5h19 T C 16: 58,856,580 (GRCm39) I173M possibly damaging Het
Or8g4 T A 9: 39,662,204 (GRCm39) I174K probably damaging Het
Or8k35 T C 2: 86,424,278 (GRCm39) K298R possibly damaging Het
Papln T C 12: 83,823,918 (GRCm39) V499A probably benign Het
Paxip1 G T 5: 27,977,078 (GRCm39) P328Q unknown Het
Pcnx2 T C 8: 126,604,306 (GRCm39) H650R probably benign Het
Pcnx3 A T 19: 5,735,206 (GRCm39) V540E possibly damaging Het
Pnpla5 C T 15: 84,002,819 (GRCm39) G255R probably damaging Het
Ppdpf G T 2: 180,829,646 (GRCm39) E34* probably null Het
Pum3 T C 19: 27,394,199 (GRCm39) Y357C probably damaging Het
R3hdm2 T G 10: 127,293,521 (GRCm39) S142A probably damaging Het
Rasa3 A T 8: 13,727,391 (GRCm39) probably null Het
Rcor2 T A 19: 7,246,340 (GRCm39) M5K possibly damaging Het
Rere A G 4: 150,593,332 (GRCm39) T309A unknown Het
Ryr1 A T 7: 28,776,297 (GRCm39) I2250N probably damaging Het
Sema6c T C 3: 95,075,341 (GRCm39) V130A probably benign Het
Slc26a9 T A 1: 131,683,155 (GRCm39) S200T probably damaging Het
Slc38a10 A G 11: 120,023,519 (GRCm39) L299P possibly damaging Het
Smim10l1 G T 6: 133,084,848 (GRCm39) V72L unknown Het
Sptbn2 C A 19: 4,782,052 (GRCm39) F430L probably damaging Het
Svep1 T A 4: 58,118,145 (GRCm39) Y859F possibly damaging Het
Svil C A 18: 5,056,098 (GRCm39) Q324K possibly damaging Het
Tgfb1i1 A T 7: 127,852,049 (GRCm39) D377V probably damaging Het
Tmed10 C A 12: 85,390,254 (GRCm39) W203L probably damaging Het
Tmem51 T A 4: 141,765,056 (GRCm39) M1L possibly damaging Het
Tmprss11e A G 5: 86,855,259 (GRCm39) V382A probably benign Het
Tnfrsf13b G T 11: 61,038,350 (GRCm39) R211L possibly damaging Het
Tns3 A G 11: 8,468,273 (GRCm39) V317A probably damaging Het
Top3a G A 11: 60,631,363 (GRCm39) P1000S possibly damaging Het
Traj32 A T 14: 54,423,587 (GRCm39) I10F Het
Trav8-1 T A 14: 53,707,677 (GRCm39) C106S probably damaging Het
Trbv2 A G 6: 41,024,655 (GRCm39) I24V probably benign Het
Ubap2 A G 4: 41,209,351 (GRCm39) probably null Het
Vmn2r97 T A 17: 19,160,472 (GRCm39) C536S probably damaging Het
Zfp879 G T 11: 50,723,429 (GRCm39) C542* probably null Het
Znfx1 C T 2: 166,892,500 (GRCm39) probably benign Het
Other mutations in Myo15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15a APN 11 60,368,605 (GRCm39) missense probably damaging 1.00
IGL01011:Myo15a APN 11 60,367,818 (GRCm39) missense probably benign 0.33
IGL01100:Myo15a APN 11 60,401,984 (GRCm39) missense probably damaging 1.00
IGL01357:Myo15a APN 11 60,393,115 (GRCm39) splice site probably benign
IGL01634:Myo15a APN 11 60,386,298 (GRCm39) missense probably damaging 1.00
IGL01763:Myo15a APN 11 60,412,564 (GRCm39) missense probably benign 0.07
IGL01901:Myo15a APN 11 60,418,260 (GRCm39) utr 3 prime probably benign
IGL01931:Myo15a APN 11 60,386,964 (GRCm39) missense probably damaging 1.00
IGL02006:Myo15a APN 11 60,401,954 (GRCm39) missense probably damaging 1.00
IGL02041:Myo15a APN 11 60,397,689 (GRCm39) missense probably damaging 0.99
IGL02094:Myo15a APN 11 60,401,473 (GRCm39) unclassified probably benign
IGL02122:Myo15a APN 11 60,374,292 (GRCm39) missense probably benign 0.23
IGL02153:Myo15a APN 11 60,389,223 (GRCm39) missense probably damaging 1.00
IGL02328:Myo15a APN 11 60,417,433 (GRCm39) missense probably benign 0.13
IGL02330:Myo15a APN 11 60,367,987 (GRCm39) missense possibly damaging 0.94
IGL02431:Myo15a APN 11 60,401,465 (GRCm39) missense possibly damaging 0.73
IGL02639:Myo15a APN 11 60,369,447 (GRCm39) missense probably benign
IGL02659:Myo15a APN 11 60,382,609 (GRCm39) splice site probably benign
IGL02800:Myo15a APN 11 60,393,195 (GRCm39) missense probably damaging 1.00
IGL02812:Myo15a APN 11 60,368,005 (GRCm39) missense probably benign 0.15
IGL02863:Myo15a APN 11 60,368,953 (GRCm39) missense probably damaging 1.00
IGL02873:Myo15a APN 11 60,374,308 (GRCm39) missense probably damaging 1.00
IGL02990:Myo15a APN 11 60,370,266 (GRCm39) missense probably benign 0.02
IGL03011:Myo15a APN 11 60,400,357 (GRCm39) splice site probably benign
IGL03243:Myo15a APN 11 60,387,344 (GRCm39) missense probably damaging 1.00
IGL03297:Myo15a APN 11 60,369,967 (GRCm39) missense probably damaging 1.00
novichok UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
parker UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
Typhoon UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
PIT4131001:Myo15a UTSW 11 60,386,280 (GRCm39) missense probably damaging 1.00
PIT4131001:Myo15a UTSW 11 60,373,953 (GRCm39) missense probably damaging 1.00
R0133:Myo15a UTSW 11 60,368,676 (GRCm39) missense possibly damaging 0.94
R0265:Myo15a UTSW 11 60,405,723 (GRCm39) critical splice acceptor site probably null
R0389:Myo15a UTSW 11 60,369,364 (GRCm39) missense probably benign
R0416:Myo15a UTSW 11 60,402,000 (GRCm39) missense probably damaging 1.00
R0449:Myo15a UTSW 11 60,400,422 (GRCm39) missense possibly damaging 0.92
R0477:Myo15a UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
R0543:Myo15a UTSW 11 60,369,877 (GRCm39) missense probably benign
R0546:Myo15a UTSW 11 60,397,139 (GRCm39) missense probably damaging 1.00
R0555:Myo15a UTSW 11 60,412,464 (GRCm39) missense probably damaging 1.00
R0639:Myo15a UTSW 11 60,370,162 (GRCm39) missense probably benign 0.12
R0723:Myo15a UTSW 11 60,369,803 (GRCm39) missense possibly damaging 0.94
R0837:Myo15a UTSW 11 60,378,077 (GRCm39) missense probably damaging 0.98
R0865:Myo15a UTSW 11 60,382,514 (GRCm39) missense probably damaging 1.00
R0899:Myo15a UTSW 11 60,368,011 (GRCm39) missense possibly damaging 0.87
R1022:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1024:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1035:Myo15a UTSW 11 60,401,384 (GRCm39) unclassified probably benign
R1109:Myo15a UTSW 11 60,383,892 (GRCm39) missense probably damaging 1.00
R1170:Myo15a UTSW 11 60,370,233 (GRCm39) missense probably benign 0.04
R1241:Myo15a UTSW 11 60,390,256 (GRCm39) missense possibly damaging 0.58
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1434:Myo15a UTSW 11 60,395,157 (GRCm39) missense probably benign 0.00
R1450:Myo15a UTSW 11 60,386,308 (GRCm39) missense probably damaging 1.00
R1456:Myo15a UTSW 11 60,399,028 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1548:Myo15a UTSW 11 60,379,064 (GRCm39) missense probably damaging 1.00
R1551:Myo15a UTSW 11 60,383,791 (GRCm39) missense possibly damaging 0.70
R1571:Myo15a UTSW 11 60,409,290 (GRCm39) missense probably damaging 1.00
R1662:Myo15a UTSW 11 60,392,527 (GRCm39) missense probably damaging 1.00
R1777:Myo15a UTSW 11 60,405,762 (GRCm39) missense probably benign
R1778:Myo15a UTSW 11 60,369,238 (GRCm39) missense possibly damaging 0.57
R1847:Myo15a UTSW 11 60,390,321 (GRCm39) nonsense probably null
R1875:Myo15a UTSW 11 60,398,354 (GRCm39) missense probably damaging 0.99
R1944:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R1945:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R2013:Myo15a UTSW 11 60,385,057 (GRCm39) missense probably damaging 1.00
R2107:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2108:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2112:Myo15a UTSW 11 60,384,994 (GRCm39) missense probably damaging 0.99
R2147:Myo15a UTSW 11 60,401,055 (GRCm39) missense possibly damaging 0.66
R2196:Myo15a UTSW 11 60,400,847 (GRCm39) nonsense probably null
R2207:Myo15a UTSW 11 60,396,860 (GRCm39) missense probably benign 0.01
R2245:Myo15a UTSW 11 60,399,925 (GRCm39) missense probably damaging 1.00
R2367:Myo15a UTSW 11 60,408,064 (GRCm39) missense probably damaging 0.99
R2374:Myo15a UTSW 11 60,369,669 (GRCm39) missense possibly damaging 0.88
R2438:Myo15a UTSW 11 60,373,878 (GRCm39) missense probably damaging 1.00
R3154:Myo15a UTSW 11 60,370,186 (GRCm39) splice site probably null
R3423:Myo15a UTSW 11 60,401,126 (GRCm39) critical splice donor site probably null
R3551:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3552:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3612:Myo15a UTSW 11 60,368,505 (GRCm39) missense probably damaging 1.00
R3620:Myo15a UTSW 11 60,369,468 (GRCm39) missense possibly damaging 0.63
R3713:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3714:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3715:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3783:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3784:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3785:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3786:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3787:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3894:Myo15a UTSW 11 60,395,145 (GRCm39) missense probably benign 0.00
R3962:Myo15a UTSW 11 60,370,654 (GRCm39) missense probably benign 0.00
R4082:Myo15a UTSW 11 60,378,022 (GRCm39) missense possibly damaging 0.92
R4555:Myo15a UTSW 11 60,387,763 (GRCm39) missense probably damaging 1.00
R4641:Myo15a UTSW 11 60,393,867 (GRCm39) missense probably damaging 1.00
R4665:Myo15a UTSW 11 60,395,705 (GRCm39) critical splice acceptor site probably null
R4713:Myo15a UTSW 11 60,370,756 (GRCm39) missense probably benign 0.21
R4820:Myo15a UTSW 11 60,367,741 (GRCm39) missense probably damaging 0.98
R5013:Myo15a UTSW 11 60,382,493 (GRCm39) missense probably damaging 1.00
R5051:Myo15a UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
R5187:Myo15a UTSW 11 60,394,440 (GRCm39) missense probably damaging 1.00
R5230:Myo15a UTSW 11 60,393,674 (GRCm39) missense possibly damaging 0.68
R5277:Myo15a UTSW 11 60,367,940 (GRCm39) nonsense probably null
R5345:Myo15a UTSW 11 60,388,364 (GRCm39) missense probably damaging 0.99
R5349:Myo15a UTSW 11 60,384,409 (GRCm39) missense probably damaging 1.00
R5356:Myo15a UTSW 11 60,389,192 (GRCm39) missense probably damaging 1.00
R5445:Myo15a UTSW 11 60,411,603 (GRCm39) nonsense probably null
R5477:Myo15a UTSW 11 60,368,503 (GRCm39) missense probably damaging 1.00
R5629:Myo15a UTSW 11 60,370,578 (GRCm39) missense probably benign
R5728:Myo15a UTSW 11 60,379,722 (GRCm39) missense probably damaging 1.00
R5818:Myo15a UTSW 11 60,388,777 (GRCm39) missense probably benign 0.06
R5952:Myo15a UTSW 11 60,370,246 (GRCm39) missense possibly damaging 0.50
R6338:Myo15a UTSW 11 60,368,959 (GRCm39) missense probably damaging 0.99
R6467:Myo15a UTSW 11 60,417,487 (GRCm39) critical splice donor site probably null
R6488:Myo15a UTSW 11 60,369,313 (GRCm39) missense possibly damaging 0.86
R6521:Myo15a UTSW 11 60,393,195 (GRCm39) missense probably damaging 1.00
R6645:Myo15a UTSW 11 60,368,118 (GRCm39) missense probably benign 0.00
R6702:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6703:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6821:Myo15a UTSW 11 60,415,301 (GRCm39) missense probably damaging 1.00
R6882:Myo15a UTSW 11 60,414,832 (GRCm39) missense probably damaging 1.00
R6908:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R6932:Myo15a UTSW 11 60,390,320 (GRCm39) missense probably damaging 1.00
R6958:Myo15a UTSW 11 60,394,451 (GRCm39) missense probably benign 0.07
R7041:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R7149:Myo15a UTSW 11 60,400,836 (GRCm39) missense possibly damaging 0.56
R7163:Myo15a UTSW 11 60,389,195 (GRCm39) missense
R7229:Myo15a UTSW 11 60,387,321 (GRCm39) missense probably benign 0.08
R7347:Myo15a UTSW 11 60,368,787 (GRCm39) missense probably benign
R7368:Myo15a UTSW 11 60,381,741 (GRCm39) splice site probably null
R7392:Myo15a UTSW 11 60,396,802 (GRCm39) missense
R7414:Myo15a UTSW 11 60,374,309 (GRCm39) missense
R7461:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7609:Myo15a UTSW 11 60,379,637 (GRCm39) missense
R7613:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7734:Myo15a UTSW 11 60,401,108 (GRCm39) missense probably benign
R7748:Myo15a UTSW 11 60,395,727 (GRCm39) missense
R7767:Myo15a UTSW 11 60,392,922 (GRCm39) missense
R7769:Myo15a UTSW 11 60,399,975 (GRCm39) missense
R7894:Myo15a UTSW 11 60,381,963 (GRCm39) missense
R7919:Myo15a UTSW 11 60,417,356 (GRCm39) missense probably damaging 1.00
R8100:Myo15a UTSW 11 60,408,016 (GRCm39) missense probably damaging 1.00
R8124:Myo15a UTSW 11 60,398,279 (GRCm39) missense
R8129:Myo15a UTSW 11 60,399,026 (GRCm39) missense
R8428:Myo15a UTSW 11 60,387,241 (GRCm39) missense probably damaging 1.00
R8706:Myo15a UTSW 11 60,370,443 (GRCm39) missense probably benign
R8735:Myo15a UTSW 11 60,401,679 (GRCm39) critical splice acceptor site probably null
R8739:Myo15a UTSW 11 60,368,088 (GRCm39) missense probably benign 0.06
R8790:Myo15a UTSW 11 60,367,362 (GRCm39) missense possibly damaging 0.73
R8822:Myo15a UTSW 11 60,367,740 (GRCm39) missense probably damaging 0.99
R8907:Myo15a UTSW 11 60,417,434 (GRCm39) missense
R8931:Myo15a UTSW 11 60,368,020 (GRCm39) missense probably benign
R9061:Myo15a UTSW 11 60,393,692 (GRCm39) missense
R9124:Myo15a UTSW 11 60,369,952 (GRCm39) missense probably benign 0.37
R9297:Myo15a UTSW 11 60,385,899 (GRCm39) missense probably null
R9347:Myo15a UTSW 11 60,374,555 (GRCm39) missense
R9417:Myo15a UTSW 11 60,378,243 (GRCm39) missense
R9456:Myo15a UTSW 11 60,392,668 (GRCm39) missense
R9460:Myo15a UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
R9615:Myo15a UTSW 11 60,374,320 (GRCm39) missense
R9630:Myo15a UTSW 11 60,407,988 (GRCm39) missense probably damaging 1.00
R9746:Myo15a UTSW 11 60,378,234 (GRCm39) nonsense probably null
X0021:Myo15a UTSW 11 60,373,185 (GRCm39) nonsense probably null
X0066:Myo15a UTSW 11 60,369,046 (GRCm39) missense probably damaging 1.00
X0067:Myo15a UTSW 11 60,369,444 (GRCm39) missense possibly damaging 0.88
Z1176:Myo15a UTSW 11 60,389,229 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,379,084 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,415,267 (GRCm39) missense probably damaging 1.00
Z1177:Myo15a UTSW 11 60,386,301 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,379,663 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,368,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAATCTACTTCAGATCGCCC -3'
(R):5'- TACCTGGAACACAATCCTTGAC -3'

Sequencing Primer
(F):5'- AGATCGCCCCGCCAAAGG -3'
(R):5'- TGGAACACAATCCTTGACTTCTCCAG -3'
Posted On 2021-04-30