Incidental Mutation 'R8790:Tnfrsf13b'
ID 670887
Institutional Source Beutler Lab
Gene Symbol Tnfrsf13b
Ensembl Gene ENSMUSG00000010142
Gene Name tumor necrosis factor receptor superfamily, member 13b
Synonyms Taci, 1200009E08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 61126755-61149372 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 61147524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 211 (R211L)
Ref Sequence ENSEMBL: ENSMUSP00000010286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010286] [ENSMUST00000041683] [ENSMUST00000101103] [ENSMUST00000139422] [ENSMUST00000146033]
AlphaFold Q9ET35
Predicted Effect possibly damaging
Transcript: ENSMUST00000010286
AA Change: R211L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142
AA Change: R211L

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041683
SMART Domains Protein: ENSMUSP00000041263
Gene: ENSMUSG00000042506

DomainStartEndE-ValueType
Pfam:zf-UBP 63 124 5.5e-16 PFAM
Pfam:UCH 175 517 5.5e-60 PFAM
Pfam:UCH_1 176 501 2.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101103
AA Change: R211L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098662
Gene: ENSMUSG00000010142
AA Change: R211L

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 81 2.6e-33 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146033
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show increased B cell numbers and splenomegaly. Homozygotes for a null allele show impaired T cell-independent immune responses and isotype switching. Homozygotes for another null allele develop lymphoproliferation and fatal autoimmune nephritis with high titers of autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,092,451 P68S possibly damaging Het
Abcb5 T A 12: 118,867,885 N1244I possibly damaging Het
Abcb9 A G 5: 124,077,241 I479T probably damaging Het
Abi3bp A T 16: 56,675,074 I920F probably damaging Het
Adcy6 T A 15: 98,599,000 T465S probably damaging Het
Ankrd12 A T 17: 65,983,158 I1760N possibly damaging Het
Aoah C T 13: 20,851,670 R140C probably benign Het
Bmp7 T A 2: 172,870,267 D388V probably benign Het
Bphl C T 13: 34,060,485 A195V probably benign Het
Cckar A G 5: 53,699,949 V373A probably damaging Het
Cd79b T G 11: 106,312,047 D243A possibly damaging Het
Cdc25a T A 9: 109,887,348 probably null Het
Cfap57 T A 4: 118,581,914 Q805L possibly damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Cluap1 T A 16: 3,917,923 probably benign Het
Cyp2b9 A G 7: 26,198,742 probably benign Het
D930020B18Rik G A 10: 121,667,663 G248S possibly damaging Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Dmkn G A 7: 30,764,024 S34N probably benign Het
Dnaaf2 T C 12: 69,197,294 D331G probably damaging Het
Dnah1 A T 14: 31,296,275 Y1429N possibly damaging Het
Dnajc5b T A 3: 19,546,817 L26Q probably damaging Het
Epb41l1 T G 2: 156,503,802 F242V possibly damaging Het
Esam A T 9: 37,531,631 I72F probably benign Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam98a A G 17: 75,547,689 F42L possibly damaging Het
Fras1 C T 5: 96,755,377 P3038S probably damaging Het
Gm32742 C A 9: 51,147,840 G1035C probably damaging Het
Irf5 T A 6: 29,535,027 probably benign Het
Jam2 T A 16: 84,809,371 I91K possibly damaging Het
Klhdc3 A G 17: 46,680,700 probably benign Het
Lgi1 C T 19: 38,300,848 S215F possibly damaging Het
Lrp1 G A 10: 127,539,077 T4504I probably damaging Het
Mafa T A 15: 75,747,375 H183L probably benign Het
Map2 T C 1: 66,438,838 V1773A probably damaging Het
Mesp1 G A 7: 79,793,077 R151* probably null Het
Mphosph9 T C 5: 124,315,673 D192G probably damaging Het
Mthfr C A 4: 148,055,534 D678E probably benign Het
Myo15 A C 11: 60,476,536 T41P possibly damaging Het
Myo15 G T 11: 60,487,221 R185L Het
Myom2 T G 8: 15,119,242 L1136W probably damaging Het
Naa30 A G 14: 49,180,751 D316G probably benign Het
Ngef T C 1: 87,477,597 Q697R probably benign Het
Nin T C 12: 70,021,019 R1945G Het
Obox8 A T 7: 14,332,983 Y45* probably null Het
Ocln C T 13: 100,506,219 V452I probably benign Het
Olfr1082 T C 2: 86,593,934 K298R possibly damaging Het
Olfr187 T C 16: 59,036,217 I173M possibly damaging Het
Olfr76 T C 19: 12,120,542 N57D probably damaging Het
Olfr967 T A 9: 39,750,908 I174K probably damaging Het
Oog3 T A 4: 144,159,140 D296V possibly damaging Het
Papln T C 12: 83,777,144 V499A probably benign Het
Paxip1 G T 5: 27,772,080 P328Q unknown Het
Pcnx2 T C 8: 125,877,567 H650R probably benign Het
Pcnx3 A T 19: 5,685,178 V540E possibly damaging Het
Pnpla5 C T 15: 84,118,618 G255R probably damaging Het
Ppdpf G T 2: 181,187,853 E34* probably null Het
Pum3 T C 19: 27,416,799 Y357C probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rasa3 A T 8: 13,677,391 probably null Het
Rcor2 T A 19: 7,268,975 M5K possibly damaging Het
Rere A G 4: 150,508,875 T309A unknown Het
Ryr1 A T 7: 29,076,872 I2250N probably damaging Het
Sema6c T C 3: 95,168,030 V130A probably benign Het
Slc26a9 T A 1: 131,755,417 S200T probably damaging Het
Slc38a10 A G 11: 120,132,693 L299P possibly damaging Het
Smim10l1 G T 6: 133,107,885 V72L unknown Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svep1 T A 4: 58,118,145 Y859F possibly damaging Het
Svil C A 18: 5,056,098 Q324K possibly damaging Het
Tgfb1i1 A T 7: 128,252,877 D377V probably damaging Het
Tmed10 C A 12: 85,343,480 W203L probably damaging Het
Tmem51 T A 4: 142,037,745 M1L possibly damaging Het
Tmprss11e A G 5: 86,707,400 V382A probably benign Het
Tns3 A G 11: 8,518,273 V317A probably damaging Het
Top3a G A 11: 60,740,537 P1000S possibly damaging Het
Traj32 A T 14: 54,186,130 I10F Het
Trav8-1 T A 14: 53,470,220 C106S probably damaging Het
Trbv2 A G 6: 41,047,721 I24V probably benign Het
Ubap2 A G 4: 41,209,351 probably null Het
Vmn2r97 T A 17: 18,940,210 C536S probably damaging Het
Zfp879 G T 11: 50,832,602 C542* probably null Het
Znfx1 C T 2: 167,050,580 probably benign Het
Other mutations in Tnfrsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Tnfrsf13b APN 11 61141320 missense possibly damaging 0.51
R0523:Tnfrsf13b UTSW 11 61147587 missense probably benign 0.33
R2297:Tnfrsf13b UTSW 11 61147445 missense probably benign
R2517:Tnfrsf13b UTSW 11 61141476 missense probably benign 0.27
R4298:Tnfrsf13b UTSW 11 61140817 splice site probably null
R4299:Tnfrsf13b UTSW 11 61140817 splice site probably null
R4454:Tnfrsf13b UTSW 11 61141438 missense probably benign 0.33
R4931:Tnfrsf13b UTSW 11 61140937 missense possibly damaging 0.66
R5416:Tnfrsf13b UTSW 11 61147023 splice site probably null
R7995:Tnfrsf13b UTSW 11 61140916 nonsense probably null
R8531:Tnfrsf13b UTSW 11 61140951 critical splice donor site probably null
R8858:Tnfrsf13b UTSW 11 61147537 missense possibly damaging 0.73
RF013:Tnfrsf13b UTSW 11 61141444 missense probably benign
Z1176:Tnfrsf13b UTSW 11 61147010 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGAAAACCTGTTCAGGGGCG -3'
(R):5'- AAGGCACAGGTTGACTGCTC -3'

Sequencing Primer
(F):5'- CTCAGAAGGGCAAGTCCTG -3'
(R):5'- TTGACTGCTCTGGAAAGTATAGGAC -3'
Posted On 2021-04-30