Incidental Mutation 'R8790:Nin'
ID 670892
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8790 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70021019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 1945 (R1945G)
Ref Sequence ENSEMBL: ENSMUSP00000082422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect possibly damaging
Transcript: ENSMUST00000021468
AA Change: R1954G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: R1954G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: R1945G

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095666
AA Change: R1954G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: R1954G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169074
AA Change: R1954G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: R1954G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220689
AA Change: E1267G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000223257
AA Change: E1974G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,092,451 P68S possibly damaging Het
Abcb5 T A 12: 118,867,885 N1244I possibly damaging Het
Abcb9 A G 5: 124,077,241 I479T probably damaging Het
Abi3bp A T 16: 56,675,074 I920F probably damaging Het
Adcy6 T A 15: 98,599,000 T465S probably damaging Het
Ankrd12 A T 17: 65,983,158 I1760N possibly damaging Het
Aoah C T 13: 20,851,670 R140C probably benign Het
Bmp7 T A 2: 172,870,267 D388V probably benign Het
Bphl C T 13: 34,060,485 A195V probably benign Het
Cckar A G 5: 53,699,949 V373A probably damaging Het
Cd79b T G 11: 106,312,047 D243A possibly damaging Het
Cdc25a T A 9: 109,887,348 probably null Het
Cfap57 T A 4: 118,581,914 Q805L possibly damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Cluap1 T A 16: 3,917,923 probably benign Het
Cyp2b9 A G 7: 26,198,742 probably benign Het
D930020B18Rik G A 10: 121,667,663 G248S possibly damaging Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Dmkn G A 7: 30,764,024 S34N probably benign Het
Dnaaf2 T C 12: 69,197,294 D331G probably damaging Het
Dnah1 A T 14: 31,296,275 Y1429N possibly damaging Het
Dnajc5b T A 3: 19,546,817 L26Q probably damaging Het
Epb41l1 T G 2: 156,503,802 F242V possibly damaging Het
Esam A T 9: 37,531,631 I72F probably benign Het
Fam110a C T 2: 151,970,418 R144H probably damaging Het
Fam186a T C 15: 99,943,143 D1740G possibly damaging Het
Fam98a A G 17: 75,547,689 F42L possibly damaging Het
Fras1 C T 5: 96,755,377 P3038S probably damaging Het
Gm32742 C A 9: 51,147,840 G1035C probably damaging Het
Irf5 T A 6: 29,535,027 probably benign Het
Jam2 T A 16: 84,809,371 I91K possibly damaging Het
Klhdc3 A G 17: 46,680,700 probably benign Het
Lgi1 C T 19: 38,300,848 S215F possibly damaging Het
Lrp1 G A 10: 127,539,077 T4504I probably damaging Het
Mafa T A 15: 75,747,375 H183L probably benign Het
Map2 T C 1: 66,438,838 V1773A probably damaging Het
Mesp1 G A 7: 79,793,077 R151* probably null Het
Mphosph9 T C 5: 124,315,673 D192G probably damaging Het
Mthfr C A 4: 148,055,534 D678E probably benign Het
Myo15 A C 11: 60,476,536 T41P possibly damaging Het
Myo15 G T 11: 60,487,221 R185L Het
Myom2 T G 8: 15,119,242 L1136W probably damaging Het
Naa30 A G 14: 49,180,751 D316G probably benign Het
Ngef T C 1: 87,477,597 Q697R probably benign Het
Obox8 A T 7: 14,332,983 Y45* probably null Het
Ocln C T 13: 100,506,219 V452I probably benign Het
Olfr1082 T C 2: 86,593,934 K298R possibly damaging Het
Olfr187 T C 16: 59,036,217 I173M possibly damaging Het
Olfr76 T C 19: 12,120,542 N57D probably damaging Het
Olfr967 T A 9: 39,750,908 I174K probably damaging Het
Oog3 T A 4: 144,159,140 D296V possibly damaging Het
Papln T C 12: 83,777,144 V499A probably benign Het
Paxip1 G T 5: 27,772,080 P328Q unknown Het
Pcnx2 T C 8: 125,877,567 H650R probably benign Het
Pcnx3 A T 19: 5,685,178 V540E possibly damaging Het
Pnpla5 C T 15: 84,118,618 G255R probably damaging Het
Ppdpf G T 2: 181,187,853 E34* probably null Het
Pum3 T C 19: 27,416,799 Y357C probably damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rasa3 A T 8: 13,677,391 probably null Het
Rcor2 T A 19: 7,268,975 M5K possibly damaging Het
Rere A G 4: 150,508,875 T309A unknown Het
Ryr1 A T 7: 29,076,872 I2250N probably damaging Het
Sema6c T C 3: 95,168,030 V130A probably benign Het
Slc26a9 T A 1: 131,755,417 S200T probably damaging Het
Slc38a10 A G 11: 120,132,693 L299P possibly damaging Het
Smim10l1 G T 6: 133,107,885 V72L unknown Het
Sptbn2 C A 19: 4,732,024 F430L probably damaging Het
Svep1 T A 4: 58,118,145 Y859F possibly damaging Het
Svil C A 18: 5,056,098 Q324K possibly damaging Het
Tgfb1i1 A T 7: 128,252,877 D377V probably damaging Het
Tmed10 C A 12: 85,343,480 W203L probably damaging Het
Tmem51 T A 4: 142,037,745 M1L possibly damaging Het
Tmprss11e A G 5: 86,707,400 V382A probably benign Het
Tnfrsf13b G T 11: 61,147,524 R211L possibly damaging Het
Tns3 A G 11: 8,518,273 V317A probably damaging Het
Top3a G A 11: 60,740,537 P1000S possibly damaging Het
Traj32 A T 14: 54,186,130 I10F Het
Trav8-1 T A 14: 53,470,220 C106S probably damaging Het
Trbv2 A G 6: 41,047,721 I24V probably benign Het
Ubap2 A G 4: 41,209,351 probably null Het
Vmn2r97 T A 17: 18,940,210 C536S probably damaging Het
Zfp879 G T 11: 50,832,602 C542* probably null Het
Znfx1 C T 2: 167,050,580 probably benign Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8754:Nin UTSW 12 70031013 intron probably benign
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
R8974:Nin UTSW 12 70078158 missense
R9085:Nin UTSW 12 70030012 nonsense probably null
R9143:Nin UTSW 12 70090575 missense
R9380:Nin UTSW 12 70028031 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- CGGGAGAAGAACACTCTGTAC -3'
(R):5'- GAGTTATCTCCAGGGAGCAAC -3'

Sequencing Primer
(F):5'- AAGAACACTCTGTACCTGTGGTG -3'
(R):5'- GAGCAACAAAAGGGTTCTTCC -3'
Posted On 2021-04-30