Mutagenetix > Incidental Mutation

Incidental Mutation 'R8790:Nin'

670892

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

068634-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8790 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70021019 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1945 (R1945G)

Ref Sequence

ENSEMBL: ENSMUSP00000082422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021468
AA Change: R1954G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: R1954G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: R1945G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095666
AA Change: R1954G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: R1954G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169074
AA Change: R1954G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: R1954G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220689
AA Change: E1267G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000223257
AA Change: E1974G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	G	A	10: 79,092,451	P68S	possibly damaging	Het
Abcb5	T	A	12: 118,867,885	N1244I	possibly damaging	Het
Abcb9	A	G	5: 124,077,241	I479T	probably damaging	Het
Abi3bp	A	T	16: 56,675,074	I920F	probably damaging	Het
Adcy6	T	A	15: 98,599,000	T465S	probably damaging	Het
Ankrd12	A	T	17: 65,983,158	I1760N	possibly damaging	Het
Aoah	C	T	13: 20,851,670	R140C	probably benign	Het
Bmp7	T	A	2: 172,870,267	D388V	probably benign	Het
Bphl	C	T	13: 34,060,485	A195V	probably benign	Het
Cckar	A	G	5: 53,699,949	V373A	probably damaging	Het
Cd79b	T	G	11: 106,312,047	D243A	possibly damaging	Het
Cdc25a	T	A	9: 109,887,348		probably null	Het
Cfap57	T	A	4: 118,581,914	Q805L	possibly damaging	Het
Ckap2l	A	T	2: 129,269,252	M675K	possibly damaging	Het
Cluap1	T	A	16: 3,917,923		probably benign	Het
Cyp2b9	A	G	7: 26,198,742		probably benign	Het
D930020B18Rik	G	A	10: 121,667,663	G248S	possibly damaging	Het
Ddx1	A	T	12: 13,223,992	I570N	probably damaging	Het
Dmkn	G	A	7: 30,764,024	S34N	probably benign	Het
Dnaaf2	T	C	12: 69,197,294	D331G	probably damaging	Het
Dnah1	A	T	14: 31,296,275	Y1429N	possibly damaging	Het
Dnajc5b	T	A	3: 19,546,817	L26Q	probably damaging	Het
Epb41l1	T	G	2: 156,503,802	F242V	possibly damaging	Het
Esam	A	T	9: 37,531,631	I72F	probably benign	Het
Fam110a	C	T	2: 151,970,418	R144H	probably damaging	Het
Fam186a	T	C	15: 99,943,143	D1740G	possibly damaging	Het
Fam98a	A	G	17: 75,547,689	F42L	possibly damaging	Het
Fras1	C	T	5: 96,755,377	P3038S	probably damaging	Het
Gm32742	C	A	9: 51,147,840	G1035C	probably damaging	Het
Irf5	T	A	6: 29,535,027		probably benign	Het
Jam2	T	A	16: 84,809,371	I91K	possibly damaging	Het
Klhdc3	A	G	17: 46,680,700		probably benign	Het
Lgi1	C	T	19: 38,300,848	S215F	possibly damaging	Het
Lrp1	G	A	10: 127,539,077	T4504I	probably damaging	Het
Mafa	T	A	15: 75,747,375	H183L	probably benign	Het
Map2	T	C	1: 66,438,838	V1773A	probably damaging	Het
Mesp1	G	A	7: 79,793,077	R151*	probably null	Het
Mphosph9	T	C	5: 124,315,673	D192G	probably damaging	Het
Mthfr	C	A	4: 148,055,534	D678E	probably benign	Het
Myo15	A	C	11: 60,476,536	T41P	possibly damaging	Het
Myo15	G	T	11: 60,487,221	R185L		Het
Myom2	T	G	8: 15,119,242	L1136W	probably damaging	Het
Naa30	A	G	14: 49,180,751	D316G	probably benign	Het
Ngef	T	C	1: 87,477,597	Q697R	probably benign	Het
Obox8	A	T	7: 14,332,983	Y45*	probably null	Het
Ocln	C	T	13: 100,506,219	V452I	probably benign	Het
Olfr1082	T	C	2: 86,593,934	K298R	possibly damaging	Het
Olfr187	T	C	16: 59,036,217	I173M	possibly damaging	Het
Olfr76	T	C	19: 12,120,542	N57D	probably damaging	Het
Olfr967	T	A	9: 39,750,908	I174K	probably damaging	Het
Oog3	T	A	4: 144,159,140	D296V	possibly damaging	Het
Papln	T	C	12: 83,777,144	V499A	probably benign	Het
Paxip1	G	T	5: 27,772,080	P328Q	unknown	Het
Pcnx2	T	C	8: 125,877,567	H650R	probably benign	Het
Pcnx3	A	T	19: 5,685,178	V540E	possibly damaging	Het
Pnpla5	C	T	15: 84,118,618	G255R	probably damaging	Het
Ppdpf	G	T	2: 181,187,853	E34*	probably null	Het
Pum3	T	C	19: 27,416,799	Y357C	probably damaging	Het
R3hdm2	T	G	10: 127,457,652	S142A	probably damaging	Het
Rasa3	A	T	8: 13,677,391		probably null	Het
Rcor2	T	A	19: 7,268,975	M5K	possibly damaging	Het
Rere	A	G	4: 150,508,875	T309A	unknown	Het
Ryr1	A	T	7: 29,076,872	I2250N	probably damaging	Het
Sema6c	T	C	3: 95,168,030	V130A	probably benign	Het
Slc26a9	T	A	1: 131,755,417	S200T	probably damaging	Het
Slc38a10	A	G	11: 120,132,693	L299P	possibly damaging	Het
Smim10l1	G	T	6: 133,107,885	V72L	unknown	Het
Sptbn2	C	A	19: 4,732,024	F430L	probably damaging	Het
Svep1	T	A	4: 58,118,145	Y859F	possibly damaging	Het
Svil	C	A	18: 5,056,098	Q324K	possibly damaging	Het
Tgfb1i1	A	T	7: 128,252,877	D377V	probably damaging	Het
Tmed10	C	A	12: 85,343,480	W203L	probably damaging	Het
Tmem51	T	A	4: 142,037,745	M1L	possibly damaging	Het
Tmprss11e	A	G	5: 86,707,400	V382A	probably benign	Het
Tnfrsf13b	G	T	11: 61,147,524	R211L	possibly damaging	Het
Tns3	A	G	11: 8,518,273	V317A	probably damaging	Het
Top3a	G	A	11: 60,740,537	P1000S	possibly damaging	Het
Traj32	A	T	14: 54,186,130	I10F		Het
Trav8-1	T	A	14: 53,470,220	C106S	probably damaging	Het
Trbv2	A	G	6: 41,047,721	I24V	probably benign	Het
Ubap2	A	G	4: 41,209,351		probably null	Het
Vmn2r97	T	A	17: 18,940,210	C536S	probably damaging	Het
Zfp879	G	T	11: 50,832,602	C542*	probably null	Het
Znfx1	C	T	2: 167,050,580		probably benign	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
R9496:Nin	UTSW	12	70055988	missense
R9638:Nin	UTSW	12	70020844	missense
R9709:Nin	UTSW	12	70102694	missense
R9745:Nin	UTSW	12	70043125	missense
R9792:Nin	UTSW	12	70047235	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- CGGGAGAAGAACACTCTGTAC -3'
(R):5'- GAGTTATCTCCAGGGAGCAAC -3'

Sequencing Primer
(F):5'- AAGAACACTCTGTACCTGTGGTG -3'
(R):5'- GAGCAACAAAAGGGTTCTTCC -3'

Posted On

2021-04-30