Incidental Mutation 'R8791:Spart'
ID 670929
Institutional Source Beutler Lab
Gene Symbol Spart
Ensembl Gene ENSMUSG00000036580
Gene Name spartin
Synonyms TAHCCP1, Spg20
MMRRC Submission 068609-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.242) question?
Stock # R8791 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 55019529-55044743 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55029100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 297 (D297G)
Ref Sequence ENSEMBL: ENSMUSP00000042367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118] [ENSMUST00000146109] [ENSMUST00000149767]
AlphaFold Q8R1X6
Predicted Effect probably benign
Transcript: ENSMUST00000044116
AA Change: D297G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580
AA Change: D297G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107971
AA Change: D297G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580
AA Change: D297G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117341
AA Change: D297G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580
AA Change: D297G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118118
AA Change: D297G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580
AA Change: D297G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146109
SMART Domains Protein: ENSMUSP00000121683
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149767
SMART Domains Protein: ENSMUSP00000119719
Gene: ENSMUSG00000036580

DomainStartEndE-ValueType
MIT 16 92 6.83e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik G T 2: 103,823,022 (GRCm39) T87K possibly damaging Het
Adar G A 3: 89,643,445 (GRCm39) R442Q probably benign Het
Agtr1b T A 3: 20,370,280 (GRCm39) S109C probably damaging Het
Akr1c6 T A 13: 4,499,373 (GRCm39) Y248N probably benign Het
Alpk2 A T 18: 65,438,597 (GRCm39) V932E probably benign Het
Apba3 T A 10: 81,105,104 (GRCm39) S126T probably benign Het
Brca2 T A 5: 150,466,061 (GRCm39) S1942T possibly damaging Het
Ccdc149 C T 5: 52,596,552 (GRCm39) C20Y probably damaging Het
Cd63 C A 10: 128,748,071 (GRCm39) N156K probably benign Het
Clvs1 A G 4: 9,429,807 (GRCm39) E270G probably damaging Het
Cplane1 A G 15: 8,216,744 (GRCm39) Y654C probably damaging Het
Dgki A T 6: 36,996,875 (GRCm39) D574E probably damaging Het
Esrrb A G 12: 86,517,056 (GRCm39) S63G probably damaging Het
Exoc1 C T 5: 76,683,412 (GRCm39) R46C probably damaging Het
Fcgr4 C A 1: 170,847,477 (GRCm39) A25D probably damaging Het
Fgf4 T C 7: 144,415,408 (GRCm39) V56A probably benign Het
Gfpt2 A G 11: 49,714,043 (GRCm39) I267V probably benign Het
Gm20939 A C 17: 95,184,648 (GRCm39) H432P probably damaging Het
Gpr179 A T 11: 97,242,739 (GRCm39) L35Q probably damaging Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Ildr1 T C 16: 36,528,762 (GRCm39) I69T probably damaging Het
Lrfn1 A G 7: 28,159,344 (GRCm39) D421G probably benign Het
Mmp15 C T 8: 96,096,288 (GRCm39) Q360* probably null Het
Nfatc2 T C 2: 168,378,214 (GRCm39) K484E probably damaging Het
Nkpd1 G C 7: 19,258,095 (GRCm39) V625L probably benign Het
Nlrp4a C A 7: 26,143,561 (GRCm39) probably benign Het
Nme9 T A 9: 99,350,301 (GRCm39) I178N probably damaging Het
Nrp2 C T 1: 62,788,356 (GRCm39) T352I probably damaging Het
Ntrk1 T C 3: 87,686,990 (GRCm39) I723V probably damaging Het
Or5p50 C T 7: 107,422,557 (GRCm39) V40M possibly damaging Het
Pias3 C A 3: 96,612,201 (GRCm39) Q553K probably benign Het
Pnp2 T G 14: 51,200,873 (GRCm39) H119Q probably benign Het
Rapgef6 T A 11: 54,459,295 (GRCm39) D156E probably benign Het
Rint1 T C 5: 24,005,594 (GRCm39) V92A probably damaging Het
Rnf148 A T 6: 23,654,993 (GRCm39) M1K probably null Het
Rnh1 C T 7: 140,742,346 (GRCm39) R404H probably benign Het
Slc4a8 T C 15: 100,705,134 (GRCm39) V832A possibly damaging Het
Snx31 A T 15: 36,537,678 (GRCm39) C167S probably benign Het
Spata13 C T 14: 60,929,275 (GRCm39) R278C probably damaging Het
Tmc1 T C 19: 20,767,209 (GRCm39) T716A probably benign Het
Tpi1 A G 6: 124,789,483 (GRCm39) V164A probably damaging Het
Trim17 A G 11: 58,862,002 (GRCm39) S345G probably benign Het
Vmn1r199 T A 13: 22,567,687 (GRCm39) L327Q probably damaging Het
Washc4 C T 10: 83,386,748 (GRCm39) T124I probably benign Het
Wdr76 C T 2: 121,357,484 (GRCm39) T180I probably benign Het
Zcchc8 T C 5: 123,845,362 (GRCm39) N333D probably benign Het
Zfp516 T C 18: 82,975,460 (GRCm39) S553P probably damaging Het
Other mutations in Spart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spart APN 3 55,029,177 (GRCm39) missense probably damaging 1.00
IGL01539:Spart APN 3 55,024,723 (GRCm39) missense possibly damaging 0.95
IGL01982:Spart APN 3 55,035,911 (GRCm39) splice site probably null
IGL02345:Spart APN 3 55,025,147 (GRCm39) splice site probably null
IGL03217:Spart APN 3 55,035,912 (GRCm39) splice site probably benign
IGL03344:Spart APN 3 55,029,106 (GRCm39) missense probably benign 0.03
BB007:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
BB017:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
R0145:Spart UTSW 3 55,035,092 (GRCm39) nonsense probably null
R0522:Spart UTSW 3 55,035,786 (GRCm39) missense probably damaging 1.00
R1506:Spart UTSW 3 55,024,992 (GRCm39) missense probably damaging 0.99
R2043:Spart UTSW 3 55,034,969 (GRCm39) missense probably damaging 1.00
R2183:Spart UTSW 3 55,024,554 (GRCm39) missense probably benign 0.43
R4022:Spart UTSW 3 55,025,157 (GRCm39) missense probably damaging 1.00
R5154:Spart UTSW 3 55,024,750 (GRCm39) missense probably damaging 1.00
R5869:Spart UTSW 3 55,042,931 (GRCm39) missense probably benign 0.00
R5987:Spart UTSW 3 55,033,962 (GRCm39) missense probably benign 0.00
R6142:Spart UTSW 3 55,024,669 (GRCm39) missense probably damaging 1.00
R6185:Spart UTSW 3 55,024,640 (GRCm39) missense probably damaging 1.00
R6652:Spart UTSW 3 55,032,248 (GRCm39) missense probably benign 0.00
R6791:Spart UTSW 3 55,034,982 (GRCm39) missense probably damaging 1.00
R7131:Spart UTSW 3 55,029,220 (GRCm39) critical splice donor site probably null
R7930:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
R8005:Spart UTSW 3 55,024,773 (GRCm39) missense probably benign 0.00
R8458:Spart UTSW 3 55,032,315 (GRCm39) missense probably damaging 1.00
R8734:Spart UTSW 3 55,032,300 (GRCm39) missense possibly damaging 0.92
R8929:Spart UTSW 3 55,035,979 (GRCm39) missense possibly damaging 0.96
R9060:Spart UTSW 3 55,032,275 (GRCm39) missense probably benign 0.02
R9172:Spart UTSW 3 55,032,267 (GRCm39) missense possibly damaging 0.68
R9539:Spart UTSW 3 55,034,924 (GRCm39) missense probably damaging 1.00
R9695:Spart UTSW 3 55,033,955 (GRCm39) missense probably benign
RF009:Spart UTSW 3 55,035,027 (GRCm39) missense probably benign 0.00
X0018:Spart UTSW 3 55,042,920 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGGAGCTGCTGGTAGAC -3'
(R):5'- CTCCTTGAAGCTACTTCGGG -3'

Sequencing Primer
(F):5'- GCTGCTGGTAGACCATCTGTAAAAC -3'
(R):5'- AAGCTACTTCGGGTCTTTGAAAGC -3'
Posted On 2021-04-30