Mutagenetix > Incidental Mutation

Incidental Mutation 'R8791:Rint1'

670934

Institutional Source

Beutler Lab

Gene Symbol

Rint1

Ensembl Gene

ENSMUSG00000028999

Gene Name

RAD50 interactor 1

Synonyms

2810450M21Rik, 1500019C06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8791 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23787711-23820369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23800596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 92 (V92A)

Ref Sequence

ENSEMBL: ENSMUSP00000030852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]

AlphaFold

Q8BZ36

Predicted Effect

probably damaging
Transcript: ENSMUST00000030852
AA Change: V92A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: V92A

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	304	784	2.3e-135	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115113
AA Change: V92A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: V92A

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	246	727	1.2e-161	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,187,260	Y654C	probably damaging	Het
4931422A03Rik	G	T	2: 103,992,677	T87K	possibly damaging	Het
Adar	G	A	3: 89,736,138	R442Q	probably benign	Het
Agtr1b	T	A	3: 20,316,116	S109C	probably damaging	Het
Akr1c6	T	A	13: 4,449,374	Y248N	probably benign	Het
Alpk2	A	T	18: 65,305,526	V932E	probably benign	Het
Apba3	T	A	10: 81,269,270	S126T	probably benign	Het
Brca2	T	A	5: 150,542,596	S1942T	possibly damaging	Het
Ccdc149	C	T	5: 52,439,210	C20Y	probably damaging	Het
Cd63	C	A	10: 128,912,202	N156K	probably benign	Het
Clvs1	A	G	4: 9,429,807	E270G	probably damaging	Het
Dgki	A	T	6: 37,019,940	D574E	probably damaging	Het
Esrrb	A	G	12: 86,470,282	S63G	probably damaging	Het
Exoc1	C	T	5: 76,535,565	R46C	probably damaging	Het
Fcgr4	C	A	1: 171,019,908	A25D	probably damaging	Het
Fgf4	T	C	7: 144,861,671	V56A	probably benign	Het
Gfpt2	A	G	11: 49,823,216	I267V	probably benign	Het
Gm20939	A	C	17: 94,877,220	H432P	probably damaging	Het
Gpr179	A	T	11: 97,351,913	L35Q	probably damaging	Het
Idh1	CA	CAA	1: 65,165,188		probably null	Het
Ildr1	T	C	16: 36,708,400	I69T	probably damaging	Het
Lrfn1	A	G	7: 28,459,919	D421G	probably benign	Het
Mmp15	C	T	8: 95,369,660	Q360*	probably null	Het
Nfatc2	T	C	2: 168,536,294	K484E	probably damaging	Het
Nkpd1	G	C	7: 19,524,170	V625L	probably benign	Het
Nlrp4a	C	A	7: 26,444,136		probably benign	Het
Nme9	T	A	9: 99,468,248	I178N	probably damaging	Het
Nrp2	C	T	1: 62,749,197	T352I	probably damaging	Het
Ntrk1	T	C	3: 87,779,683	I723V	probably damaging	Het
Olfr469	C	T	7: 107,823,350	V40M	possibly damaging	Het
Pias3	C	A	3: 96,704,885	Q553K	probably benign	Het
Pnp2	T	G	14: 50,963,416	H119Q	probably benign	Het
Rapgef6	T	A	11: 54,568,469	D156E	probably benign	Het
Rnf148	A	T	6: 23,654,994	M1K	probably null	Het
Rnh1	C	T	7: 141,162,433	R404H	probably benign	Het
Slc4a8	T	C	15: 100,807,253	V832A	possibly damaging	Het
Snx31	A	T	15: 36,537,532	C167S	probably benign	Het
Spata13	C	T	14: 60,691,826	R278C	probably damaging	Het
Spg20	A	G	3: 55,121,679	D297G	probably benign	Het
Tmc1	T	C	19: 20,789,845	T716A	probably benign	Het
Tpi1	A	G	6: 124,812,520	V164A	probably damaging	Het
Trim17	A	G	11: 58,971,176	S345G	probably benign	Het
Vmn1r199	T	A	13: 22,383,517	L327Q	probably damaging	Het
Washc4	C	T	10: 83,550,884	T124I	probably benign	Het
Wdr76	C	T	2: 121,527,003	T180I	probably benign	Het
Zcchc8	T	C	5: 123,707,299	N333D	probably benign	Het
Zfp516	T	C	18: 82,957,335	S553P	probably damaging	Het

Other mutations in Rint1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rint1	APN	5	23794431	missense	probably benign	0.00
IGL00596:Rint1	APN	5	23811865	missense	probably damaging	0.99
IGL01685:Rint1	APN	5	23787834	unclassified	probably benign
IGL02428:Rint1	APN	5	23794452	nonsense	probably null
IGL03007:Rint1	APN	5	23815701	missense	probably benign	0.00
IGL03280:Rint1	APN	5	23817078	missense	probably damaging	1.00
breakage	UTSW	5	23800722	missense	probably damaging	0.99
IGL02799:Rint1	UTSW	5	23819480	missense	possibly damaging	0.93
R0062:Rint1	UTSW	5	23787828	unclassified	probably benign
R0243:Rint1	UTSW	5	23816932	splice site	probably benign
R1102:Rint1	UTSW	5	23805567	splice site	probably benign
R1552:Rint1	UTSW	5	23800658	missense	probably benign	0.00
R1729:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R1784:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R2070:Rint1	UTSW	5	23810929	missense	possibly damaging	0.94
R2920:Rint1	UTSW	5	23805402	missense	probably benign	0.00
R3114:Rint1	UTSW	5	23819420	missense	probably benign	0.27
R4398:Rint1	UTSW	5	23794447	missense	possibly damaging	0.55
R4756:Rint1	UTSW	5	23809793	missense	probably damaging	1.00
R5246:Rint1	UTSW	5	23800811	missense	probably damaging	0.99
R5452:Rint1	UTSW	5	23794365	missense	probably benign	0.01
R5566:Rint1	UTSW	5	23810953	missense	probably damaging	1.00
R5709:Rint1	UTSW	5	23815833	missense	probably damaging	0.98
R6524:Rint1	UTSW	5	23815739	missense	probably benign	0.00
R7346:Rint1	UTSW	5	23815653	missense	possibly damaging	0.82
R7549:Rint1	UTSW	5	23815704	missense	probably benign
R7634:Rint1	UTSW	5	23805479	missense	probably benign	0.00
R7647:Rint1	UTSW	5	23800802	missense	probably damaging	1.00
R7885:Rint1	UTSW	5	23805644	missense	probably benign
R7895:Rint1	UTSW	5	23800722	missense	probably damaging	0.99
R8347:Rint1	UTSW	5	23811772	missense	probably damaging	1.00
R8900:Rint1	UTSW	5	23811884	missense	possibly damaging	0.77
R8916:Rint1	UTSW	5	23787828	unclassified	probably benign
R8973:Rint1	UTSW	5	23811730	missense	probably benign	0.00
R9245:Rint1	UTSW	5	23805413	missense	probably benign
R9339:Rint1	UTSW	5	23788357	makesense	probably null
R9630:Rint1	UTSW	5	23815812	missense	possibly damaging	0.82
R9718:Rint1	UTSW	5	23800723	missense	possibly damaging	0.53
Z1088:Rint1	UTSW	5	23805314	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTGCCTCACAAGCTGACTC -3'
(R):5'- CACCCACTTAAGGTATGCGAG -3'

Sequencing Primer
(F):5'- CCACCAGAGTACCCTGACAAGTG -3'
(R):5'- CCACTTAAGGTATGCGAGATGCC -3'

Posted On

2021-04-30