Incidental Mutation 'R8791:Zcchc8'
ID 670937
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Name zinc finger, CCHC domain containing 8
Synonyms 5730565F05Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027494; MGI: 1917900

Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R8791 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123698294-123721100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123707299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 333 (N333D)
Ref Sequence ENSEMBL: ENSMUSP00000031376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282]
AlphaFold Q9CYA6
Predicted Effect probably benign
Transcript: ENSMUST00000031376
AA Change: N333D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: N333D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196001
Predicted Effect probably benign
Transcript: ENSMUST00000196282
AA Change: N333D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: N333D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196333
Predicted Effect probably benign
Transcript: ENSMUST00000198826
Predicted Effect probably benign
Transcript: ENSMUST00000200161
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nlrp4a C A 7: 26,444,136 probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123704569 missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123720719 critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123700918 missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123719483 splice site probably benign
3-1:Zcchc8 UTSW 5 123709481 missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123700932 missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123707337 missense probably damaging 1.00
R1134:Zcchc8 UTSW 5 123717027 missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123700658 missense probably benign 0.00
R1744:Zcchc8 UTSW 5 123700373 nonsense probably null
R2216:Zcchc8 UTSW 5 123707403 missense probably damaging 1.00
R2303:Zcchc8 UTSW 5 123700597 missense probably benign 0.00
R2877:Zcchc8 UTSW 5 123700703 missense probably benign 0.05
R2964:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R2966:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123700909 missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123720720 critical splice donor site probably benign
R8738:Zcchc8 UTSW 5 123703007 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGCCATCCCTGTCATTAG -3'
(R):5'- ACTTCATGCTATGTAGTATGGGAC -3'

Sequencing Primer
(F):5'- CGAGCTGGCTTCAAACTGAGATC -3'
(R):5'- TGCTCTTTCAGAGGACACAG -3'
Posted On 2021-04-30