Incidental Mutation 'R8791:Rnh1'
ID 670945
Institutional Source Beutler Lab
Gene Symbol Rnh1
Ensembl Gene ENSMUSG00000038650
Gene Name ribonuclease/angiogenin inhibitor 1
Synonyms RNH
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R8791 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141160326-141172857 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 141162433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 404 (R404H)
Ref Sequence ENSEMBL: ENSMUSP00000147928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026568] [ENSMUST00000106033] [ENSMUST00000167493] [ENSMUST00000209378] [ENSMUST00000210314] [ENSMUST00000210979]
AlphaFold Q91VI7
Predicted Effect probably benign
Transcript: ENSMUST00000026568
SMART Domains Protein: ENSMUSP00000026568
Gene: ENSMUSG00000025495

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
Pfam:PSS 98 378 1.8e-113 PFAM
transmembrane domain 388 410 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106033
AA Change: R368H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101651
Gene: ENSMUSG00000038650
AA Change: R368H

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167493
AA Change: R368H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133061
Gene: ENSMUSG00000038650
AA Change: R368H

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209378
Predicted Effect probably benign
Transcript: ENSMUST00000210314
AA Change: R404H

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000210979
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nlrp4a C A 7: 26,444,136 probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Rnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Rnh1 APN 7 141166731 missense possibly damaging 0.49
IGL01016:Rnh1 APN 7 141164496 splice site probably benign
IGL03156:Rnh1 APN 7 141163183 missense probably damaging 1.00
R0063:Rnh1 UTSW 7 141164196 splice site probably null
R0456:Rnh1 UTSW 7 141162548 missense possibly damaging 0.90
R1086:Rnh1 UTSW 7 141163369 missense probably benign
R1223:Rnh1 UTSW 7 141163207 missense probably damaging 1.00
R1741:Rnh1 UTSW 7 141164023 missense probably benign 0.00
R1771:Rnh1 UTSW 7 141164606 missense possibly damaging 0.55
R4508:Rnh1 UTSW 7 141164543 missense possibly damaging 0.90
R5348:Rnh1 UTSW 7 141163408 missense probably damaging 0.99
R5581:Rnh1 UTSW 7 141163381 missense probably benign 0.00
R6752:Rnh1 UTSW 7 141163441 missense probably benign 0.00
R6932:Rnh1 UTSW 7 141163183 missense probably damaging 1.00
R7536:Rnh1 UTSW 7 141160812 missense possibly damaging 0.92
R8152:Rnh1 UTSW 7 141160704 missense probably damaging 1.00
R8334:Rnh1 UTSW 7 141168631 missense probably benign 0.01
R9018:Rnh1 UTSW 7 141168631 missense probably benign 0.01
R9248:Rnh1 UTSW 7 141160801 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTACATCTAGCTCACTGACCAGG -3'
(R):5'- GAAGGGCTCCTTGGAAGAACTG -3'

Sequencing Primer
(F):5'- CTGACCAGGATACACAAGAGTACTG -3'
(R):5'- GGAAGAACTGGTTCCAGCCTTTC -3'
Posted On 2021-04-30