Incidental Mutation 'R8791:Mmp15'
ID670947
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Namematrix metallopeptidase 15
SynonymsMembrane type 2-MMP, MT2-MMP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8791 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95352268-95375080 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 95369660 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 360 (Q360*)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
Predicted Effect probably null
Transcript: ENSMUST00000034243
AA Change: Q360*
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: Q360*

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
R8679:Mmp15 UTSW 8 95366354 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTCCAGCACTTTGTATAGGAG -3'
(R):5'- GGCTCTGAACAGGACTTAGAG -3'

Sequencing Primer
(F):5'- TGTAGGCTCCCCAGATGGTAAG -3'
(R):5'- CTCTGAACAGGACTTAGAGAGGCTG -3'
Posted On2021-04-30