Incidental Mutation 'R8791:Trim17'
ID 670954
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Name tripartite motif-containing 17
Synonyms terf, Rnf16
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8791 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58954685-58973098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58971176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 345 (S345G)
Ref Sequence ENSEMBL: ENSMUSP00000074639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
AlphaFold Q7TPM3
Predicted Effect probably benign
Transcript: ENSMUST00000047697
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075141
AA Change: S345G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: S345G

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nlrp4a C A 7: 26,444,136 probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
R8543:Trim17 UTSW 11 58971455 missense probably damaging 1.00
R8894:Trim17 UTSW 11 58968710 missense probably benign 0.00
R9015:Trim17 UTSW 11 58965231 missense probably damaging 0.99
R9026:Trim17 UTSW 11 58971447 missense probably benign 0.01
R9269:Trim17 UTSW 11 58971431 missense probably damaging 1.00
R9609:Trim17 UTSW 11 58965138 missense probably damaging 1.00
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Z1186:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1186:Trim17 UTSW 11 58970446 missense probably benign
Z1187:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1187:Trim17 UTSW 11 58970446 missense probably benign
Z1188:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1188:Trim17 UTSW 11 58970446 missense probably benign
Z1189:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1189:Trim17 UTSW 11 58970446 missense probably benign
Z1190:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1190:Trim17 UTSW 11 58970446 missense probably benign
Z1191:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1191:Trim17 UTSW 11 58970446 missense probably benign
Z1192:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1192:Trim17 UTSW 11 58970446 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCTTGAGGGTTCTGGCTC -3'
(R):5'- TTGGGTAACAGGGACAGCTG -3'

Sequencing Primer
(F):5'- GAGGGTTCTGGCTCATTCACC -3'
(R):5'- GGACTTAAGCACTCTGTCC -3'
Posted On 2021-04-30