Incidental Mutation 'R8791:Pnp2'
ID 670959
Institutional Source Beutler Lab
Gene Symbol Pnp2
Ensembl Gene ENSMUSG00000068417
Gene Name purine-nucleoside phosphorylase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R8791 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50955992-50964749 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 50963416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 119 (H119Q)
Ref Sequence ENSEMBL: ENSMUSP00000093615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095925] [ENSMUST00000178092] [ENSMUST00000227052]
AlphaFold Q9D8C9
Predicted Effect probably benign
Transcript: ENSMUST00000095925
AA Change: H119Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093615
Gene: ENSMUSG00000068417
AA Change: H119Q

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 41 295 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178092
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227052
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nlrp4a C A 7: 26,444,136 probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Pnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Pnp2 APN 14 50959553 missense probably damaging 1.00
IGL02418:Pnp2 APN 14 50963836 missense possibly damaging 0.51
IGL03216:Pnp2 APN 14 50963197 missense probably benign 0.01
IGL03388:Pnp2 APN 14 50963538 missense probably damaging 1.00
R0049:Pnp2 UTSW 14 50959533 nonsense probably null
R0097:Pnp2 UTSW 14 50963501 missense probably benign 0.08
R0123:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0134:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0158:Pnp2 UTSW 14 50964304 missense probably damaging 1.00
R1477:Pnp2 UTSW 14 50959535 missense probably benign 0.35
R1820:Pnp2 UTSW 14 50964457 missense possibly damaging 0.93
R1934:Pnp2 UTSW 14 50956218 missense probably benign
R2138:Pnp2 UTSW 14 50963704 missense probably damaging 1.00
R3843:Pnp2 UTSW 14 50963421 missense probably null 1.00
R4355:Pnp2 UTSW 14 50959625 missense probably benign
R4938:Pnp2 UTSW 14 50963568 splice site probably null
R5516:Pnp2 UTSW 14 50963738 missense probably benign 0.33
R5636:Pnp2 UTSW 14 50956192 splice site probably null
R6396:Pnp2 UTSW 14 50963159 missense probably damaging 1.00
R7117:Pnp2 UTSW 14 50964474 makesense probably null
R7862:Pnp2 UTSW 14 50963559 missense possibly damaging 0.95
R7934:Pnp2 UTSW 14 50964446 missense probably benign 0.00
R8057:Pnp2 UTSW 14 50964381 missense probably benign 0.06
R8104:Pnp2 UTSW 14 50959642 missense probably benign 0.00
R8488:Pnp2 UTSW 14 50964379 missense possibly damaging 0.79
R8519:Pnp2 UTSW 14 50964385 missense probably damaging 1.00
R8916:Pnp2 UTSW 14 50963777 missense probably damaging 1.00
R9592:Pnp2 UTSW 14 50959522 missense probably damaging 0.99
R9592:Pnp2 UTSW 14 50959524 nonsense probably null
R9762:Pnp2 UTSW 14 50959549 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGATGGGAGAGCTGTCCTAC -3'
(R):5'- TGGCACCAAGTGAACTTTCTTTC -3'

Sequencing Primer
(F):5'- GGAGAGCTGTCCTACTTTGTCTAAC -3'
(R):5'- AGGCCAGACTCTCTACATGTAG -3'
Posted On 2021-04-30