Incidental Mutation 'R8791:Snx31'
ID670962
Institutional Source Beutler Lab
Gene Symbol Snx31
Ensembl Gene ENSMUSG00000013611
Gene Namesorting nexin 31
Synonyms4631426E05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8791 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location36504062-36555573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36537532 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 167 (C167S)
Ref Sequence ENSEMBL: ENSMUSP00000124063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013755] [ENSMUST00000161202]
Predicted Effect probably benign
Transcript: ENSMUST00000013755
AA Change: C167S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000013755
Gene: ENSMUSG00000013611
AA Change: C167S

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161202
AA Change: C167S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000124063
Gene: ENSMUSG00000013611
AA Change: C167S

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Snx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Snx31 APN 15 36545616 critical splice acceptor site probably null
IGL01627:Snx31 APN 15 36517672 missense probably damaging 1.00
IGL02514:Snx31 APN 15 36525582 missense probably damaging 1.00
IGL03069:Snx31 APN 15 36525603 nonsense probably null
IGL03182:Snx31 APN 15 36525687 missense probably benign 0.00
R0755:Snx31 UTSW 15 36534430 missense probably damaging 0.99
R1005:Snx31 UTSW 15 36517691 splice site probably benign
R1463:Snx31 UTSW 15 36539298 missense probably null 1.00
R1513:Snx31 UTSW 15 36545600 missense probably damaging 0.99
R2030:Snx31 UTSW 15 36525702 missense probably benign 0.31
R3404:Snx31 UTSW 15 36525653 missense probably benign 0.00
R3720:Snx31 UTSW 15 36523558 critical splice acceptor site probably null
R4152:Snx31 UTSW 15 36525639 missense probably benign
R4474:Snx31 UTSW 15 36546111 intron probably benign
R4729:Snx31 UTSW 15 36523552 missense possibly damaging 0.92
R4998:Snx31 UTSW 15 36539367 missense probably damaging 0.96
R5010:Snx31 UTSW 15 36555324 missense probably damaging 1.00
R5375:Snx31 UTSW 15 36525584 missense probably damaging 0.99
R5893:Snx31 UTSW 15 36523455 missense probably damaging 0.98
R5970:Snx31 UTSW 15 36523488 nonsense probably null
R6211:Snx31 UTSW 15 36546885 missense probably damaging 0.98
R7198:Snx31 UTSW 15 36555310 missense probably benign 0.04
R7293:Snx31 UTSW 15 36523450 missense probably damaging 0.97
R7329:Snx31 UTSW 15 36555476 missense probably benign 0.00
R7741:Snx31 UTSW 15 36523441 critical splice donor site probably null
R8057:Snx31 UTSW 15 36523460 missense probably damaging 0.98
R8806:Snx31 UTSW 15 36537552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAATGACAGTCTTTTATTCTCC -3'
(R):5'- GTCTACTGGCCTGCAAAAGC -3'

Sequencing Primer
(F):5'- TGCTCATTTAAGACAGGGCC -3'
(R):5'- TGGCCTGCAAAAGCATTCG -3'
Posted On2021-04-30