Incidental Mutation 'R8791:Tmc1'
ID 670968
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
MMRRC Submission 068609-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R8791 (G1)
Quality Score 201.009
Status Validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20789845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 716 (T716A)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect probably benign
Transcript: ENSMUST00000039500
AA Change: T716A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: T716A

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 (GRCm38) Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 (GRCm38) T87K possibly damaging Het
Adar G A 3: 89,736,138 (GRCm38) R442Q probably benign Het
Agtr1b T A 3: 20,316,116 (GRCm38) S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 (GRCm38) Y248N probably benign Het
Alpk2 A T 18: 65,305,526 (GRCm38) V932E probably benign Het
Apba3 T A 10: 81,269,270 (GRCm38) S126T probably benign Het
Brca2 T A 5: 150,542,596 (GRCm38) S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 (GRCm38) C20Y probably damaging Het
Cd63 C A 10: 128,912,202 (GRCm38) N156K probably benign Het
Clvs1 A G 4: 9,429,807 (GRCm38) E270G probably damaging Het
Dgki A T 6: 37,019,940 (GRCm38) D574E probably damaging Het
Esrrb A G 12: 86,470,282 (GRCm38) S63G probably damaging Het
Exoc1 C T 5: 76,535,565 (GRCm38) R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 (GRCm38) A25D probably damaging Het
Fgf4 T C 7: 144,861,671 (GRCm38) V56A probably benign Het
Gfpt2 A G 11: 49,823,216 (GRCm38) I267V probably benign Het
Gm20939 A C 17: 94,877,220 (GRCm38) H432P probably damaging Het
Gpr179 A T 11: 97,351,913 (GRCm38) L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 (GRCm38) probably null Het
Ildr1 T C 16: 36,708,400 (GRCm38) I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 (GRCm38) D421G probably benign Het
Mmp15 C T 8: 95,369,660 (GRCm38) Q360* probably null Het
Nfatc2 T C 2: 168,536,294 (GRCm38) K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 (GRCm38) V625L probably benign Het
Nlrp4a C A 7: 26,444,136 (GRCm38) probably benign Het
Nme9 T A 9: 99,468,248 (GRCm38) I178N probably damaging Het
Nrp2 C T 1: 62,749,197 (GRCm38) T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 (GRCm38) I723V probably damaging Het
Olfr469 C T 7: 107,823,350 (GRCm38) V40M possibly damaging Het
Pias3 C A 3: 96,704,885 (GRCm38) Q553K probably benign Het
Pnp2 T G 14: 50,963,416 (GRCm38) H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 (GRCm38) D156E probably benign Het
Rint1 T C 5: 23,800,596 (GRCm38) V92A probably damaging Het
Rnf148 A T 6: 23,654,994 (GRCm38) M1K probably null Het
Rnh1 C T 7: 141,162,433 (GRCm38) R404H probably benign Het
Slc4a8 T C 15: 100,807,253 (GRCm38) V832A possibly damaging Het
Snx31 A T 15: 36,537,532 (GRCm38) C167S probably benign Het
Spata13 C T 14: 60,691,826 (GRCm38) R278C probably damaging Het
Spg20 A G 3: 55,121,679 (GRCm38) D297G probably benign Het
Tpi1 A G 6: 124,812,520 (GRCm38) V164A probably damaging Het
Trim17 A G 11: 58,971,176 (GRCm38) S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 (GRCm38) L327Q probably damaging Het
Washc4 C T 10: 83,550,884 (GRCm38) T124I probably benign Het
Wdr76 C T 2: 121,527,003 (GRCm38) T180I probably benign Het
Zcchc8 T C 5: 123,707,299 (GRCm38) N333D probably benign Het
Zfp516 T C 18: 82,957,335 (GRCm38) S553P probably damaging Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20,816,192 (GRCm38) missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20,832,454 (GRCm38) missense probably benign 0.00
IGL02245:Tmc1 APN 19 20,799,192 (GRCm38) missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20,906,963 (GRCm38) missense probably benign 0.04
IGL02699:Tmc1 APN 19 20,832,350 (GRCm38) critical splice donor site probably null
IGL02974:Tmc1 APN 19 20,900,844 (GRCm38) missense probably benign
IGL03194:Tmc1 APN 19 20,804,653 (GRCm38) missense probably damaging 1.00
dinner_bell UTSW 19 20,795,516 (GRCm38) missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20,789,587 (GRCm38) missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20,799,045 (GRCm38) missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20,799,176 (GRCm38) missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20,816,184 (GRCm38) missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20,816,184 (GRCm38) missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20,868,355 (GRCm38) missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20,816,122 (GRCm38) missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20,826,501 (GRCm38) splice site probably null
R1777:Tmc1 UTSW 19 20,816,109 (GRCm38) critical splice donor site probably null
R2067:Tmc1 UTSW 19 20,824,309 (GRCm38) missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20,856,675 (GRCm38) missense probably benign 0.01
R2180:Tmc1 UTSW 19 20,824,084 (GRCm38) missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20,940,905 (GRCm38) missense probably benign 0.01
R2205:Tmc1 UTSW 19 20,940,905 (GRCm38) missense probably benign 0.01
R2285:Tmc1 UTSW 19 20,789,799 (GRCm38) missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20,868,374 (GRCm38) missense probably benign 0.00
R4752:Tmc1 UTSW 19 20,826,649 (GRCm38) missense probably benign 0.35
R4975:Tmc1 UTSW 19 20,906,955 (GRCm38) missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20,824,030 (GRCm38) missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20,826,660 (GRCm38) missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20,804,602 (GRCm38) missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20,789,622 (GRCm38) missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20,789,590 (GRCm38) missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20,827,651 (GRCm38) critical splice donor site probably null
R6796:Tmc1 UTSW 19 20,799,036 (GRCm38) missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20,795,516 (GRCm38) missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20,900,861 (GRCm38) missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20,795,610 (GRCm38) nonsense probably null
R6978:Tmc1 UTSW 19 20,804,635 (GRCm38) missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20,824,283 (GRCm38) missense probably benign 0.02
R7027:Tmc1 UTSW 19 20,940,903 (GRCm38) critical splice donor site probably null
R7378:Tmc1 UTSW 19 20,868,389 (GRCm38) missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20,799,178 (GRCm38) missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20,907,008 (GRCm38) missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20,804,645 (GRCm38) missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20,900,817 (GRCm38) missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20,868,361 (GRCm38) missense probably benign 0.08
R8786:Tmc1 UTSW 19 20,826,589 (GRCm38) missense probably damaging 1.00
R8969:Tmc1 UTSW 19 20,816,229 (GRCm38) missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20,900,851 (GRCm38) missense probably benign
R9429:Tmc1 UTSW 19 20,816,184 (GRCm38) missense possibly damaging 0.79
R9493:Tmc1 UTSW 19 20,824,280 (GRCm38) missense probably benign 0.00
Z1176:Tmc1 UTSW 19 20,826,506 (GRCm38) missense probably null 1.00
Z1177:Tmc1 UTSW 19 20,823,982 (GRCm38) missense probably damaging 1.00
Z1177:Tmc1 UTSW 19 20,795,608 (GRCm38) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAGATTTCTTCTACTTGACATCGG -3'
(R):5'- ACCGAGATCTGGGTTCTACG -3'

Sequencing Primer
(F):5'- CTTCTACTTGACATCGGCAAGTATG -3'
(R):5'- AGATCTGGGTTCTACGTTTGCCTC -3'
Posted On 2021-04-30