Incidental Mutation 'R8792:Mlph'
ID670970
Institutional Source Beutler Lab
Gene Symbol Mlph
Ensembl Gene ENSMUSG00000026303
Gene Namemelanophilin
Synonymsl1Rk3, l(1)-3Rk, D1Wsu84e, Slac-2a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8792 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location90915085-90951142 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 90942960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027528]
Predicted Effect probably benign
Transcript: ENSMUST00000027528
SMART Domains Protein: ENSMUSP00000027528
Gene: ENSMUSG00000026303

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2e-51 PFAM
low complexity region 147 160 N/A INTRINSIC
PDB:4KP3|F 170 208 1e-18 PDB
low complexity region 379 406 N/A INTRINSIC
Pfam:Rab_eff_C 437 501 1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Mlph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mlph APN 1 90939390 missense probably damaging 1.00
IGL01779:Mlph APN 1 90942950 missense probably benign
IGL01952:Mlph APN 1 90933471 missense probably benign 0.00
beau UTSW 1 90928122 missense probably damaging 1.00
Golem UTSW 1 unclassified
koala UTSW 1 90933301 unclassified probably benign
R0652:Mlph UTSW 1 90942908 missense possibly damaging 0.89
R1374:Mlph UTSW 1 90941703 missense probably damaging 1.00
R1643:Mlph UTSW 1 90941734 missense probably damaging 1.00
R1853:Mlph UTSW 1 90945667 nonsense probably null
R2395:Mlph UTSW 1 90933506 missense probably benign 0.06
R3875:Mlph UTSW 1 90928122 missense probably damaging 1.00
R4632:Mlph UTSW 1 90939386 missense probably damaging 0.99
R4720:Mlph UTSW 1 90941697 missense probably damaging 1.00
R4963:Mlph UTSW 1 90939390 missense probably damaging 1.00
R5588:Mlph UTSW 1 90931599 missense possibly damaging 0.91
R5901:Mlph UTSW 1 90939814 missense probably damaging 1.00
R6063:Mlph UTSW 1 90928160 missense probably damaging 1.00
R6912:Mlph UTSW 1 90945620 missense probably damaging 0.98
R7019:Mlph UTSW 1 90941706 missense probably damaging 1.00
R7336:Mlph UTSW 1 90921983 splice site probably null
R7491:Mlph UTSW 1 90939378 missense possibly damaging 0.87
R7507:Mlph UTSW 1 90927707 start gained probably benign
R7648:Mlph UTSW 1 90933526 splice site probably null
R7899:Mlph UTSW 1 90941763 nonsense probably null
R8801:Mlph UTSW 1 90942887 missense probably benign 0.00
X0013:Mlph UTSW 1 90928154 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGCTTGACCAGTATCTGCAG -3'
(R):5'- GGAGGAATCCTGTGGATGTC -3'

Sequencing Primer
(F):5'- AGTATCTGCAGGGACCACTGTC -3'
(R):5'- CTGTGGATGTCAGGAGCCAGTAC -3'
Posted On2021-04-30