Incidental Mutation 'R8792:Olfr1226'
ID670977
Institutional Source Beutler Lab
Gene Symbol Olfr1226
Ensembl Gene ENSMUSG00000075097
Gene Nameolfactory receptor 1226
SynonymsGA_x6K02T2Q125-50672630-50671698, MOR233-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8792 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89188839-89200048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89193887 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 49 (Y49C)
Ref Sequence ENSEMBL: ENSMUSP00000149647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099790] [ENSMUST00000214709] [ENSMUST00000215562] [ENSMUST00000215987] [ENSMUST00000216445] [ENSMUST00000217601] [ENSMUST00000220416]
Predicted Effect probably benign
Transcript: ENSMUST00000099790
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097378
Gene: ENSMUSG00000075097
AA Change: Y49C

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 6.5e-47 PFAM
Pfam:7tm_1 39 285 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214709
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215562
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215987
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216445
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217601
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000220416
AA Change: Y49C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Olfr1226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Olfr1226 APN 2 89193504 missense probably benign 0.00
IGL01073:Olfr1226 APN 2 89193137 missense possibly damaging 0.78
IGL01539:Olfr1226 APN 2 89193492 missense possibly damaging 0.81
IGL01549:Olfr1226 APN 2 89193789 missense probably benign 0.01
IGL02040:Olfr1226 APN 2 89193563 missense probably benign 0.16
IGL02174:Olfr1226 APN 2 89193368 missense probably benign 0.01
IGL02322:Olfr1226 APN 2 89193462 missense probably damaging 0.99
IGL02881:Olfr1226 APN 2 89193641 missense probably damaging 1.00
IGL03336:Olfr1226 APN 2 89193897 missense probably benign 0.16
R1565:Olfr1226 UTSW 2 89193883 missense probably damaging 0.99
R3429:Olfr1226 UTSW 2 89193273 missense probably benign 0.04
R5668:Olfr1226 UTSW 2 89193826 missense possibly damaging 0.60
R6404:Olfr1226 UTSW 2 89193562 missense probably damaging 1.00
R6418:Olfr1226 UTSW 2 89193479 missense probably damaging 0.97
R7039:Olfr1226 UTSW 2 89193446 missense probably damaging 0.96
R7863:Olfr1226 UTSW 2 89193951 missense probably benign
R8097:Olfr1226 UTSW 2 89193632 missense probably damaging 1.00
R8544:Olfr1226 UTSW 2 89193968 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCCCAGTGAAGAAGTGCACAG -3'
(R):5'- TGCTCTTCTCTCACTCAAGTAGATG -3'

Sequencing Primer
(F):5'- CAGCAAACAGTTGTGTCATGC -3'
(R):5'- CTTCTCTCACTCAAGTAGATGTTTTC -3'
Posted On2021-04-30