Mutagenetix > Incidental Mutation

Incidental Mutation 'R8792:Strc'

670981

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R8792 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121377805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 362 (I362F)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably damaging
Transcript: ENSMUST00000038389
AA Change: I362F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: I362F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Meta Mutation Damage Score

0.1141

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco2	T	C	15: 81,909,496	I382T	probably damaging	Het
Adam39	G	T	8: 40,826,576	R668L	probably benign	Het
Adam6b	T	C	12: 113,491,690	I709T	possibly damaging	Het
Adgrl3	A	G	5: 81,688,675	E692G	probably damaging	Het
Asxl2	T	C	12: 3,496,536	L440P	probably benign	Het
Bmf	A	G	2: 118,546,905	F121L	probably damaging	Het
Cdk9	A	T	2: 32,708,257	F262L	probably benign	Het
Clock	T	A	5: 76,262,727	D99V	probably damaging	Het
Dnah14	A	T	1: 181,814,624	T102S		Het
Eps15	T	C	4: 109,305,711	V67A	probably benign	Het
Fam171b	T	A	2: 83,812,759	L4H	probably damaging	Het
Fam214b	G	A	4: 43,033,546	P536S	probably damaging	Het
Fam71d	C	T	12: 78,715,150	T196M	probably damaging	Het
Fcho2	T	A	13: 98,815,261		probably benign	Het
Gal3st4	C	T	5: 138,270,989	V70M	probably damaging	Het
Gif	C	A	19: 11,750,235	A141E	probably damaging	Het
Got1l1	C	A	8: 27,200,721		probably null	Het
Gpr146	A	G	5: 139,392,794	Y117C	probably damaging	Het
Gpr158	G	A	2: 21,553,326	V346M	probably damaging	Het
Herc1	C	A	9: 66,465,486	P3108Q	probably damaging	Het
Hoxc9	A	G	15: 102,981,794	S48G	probably benign	Het
I830077J02Rik	T	C	3: 105,927,788		probably benign	Het
Lama4	T	G	10: 39,048,052	I485M	probably benign	Het
Lrp4	C	T	2: 91,494,955	T1375I	possibly damaging	Het
Lrp6	T	C	6: 134,486,586	Y544C	probably damaging	Het
Man2b1	C	T	8: 85,095,144	Q692*	probably null	Het
Mark2	G	T	19: 7,281,215	H570N	probably benign	Het
Mlph	T	C	1: 90,942,960		probably benign	Het
Mnx1	G	A	5: 29,478,374		probably benign	Het
Nkx2-2	A	T	2: 147,177,893	V208E	probably benign	Het
Nlrp1b	T	C	11: 71,160,093	I1058V	probably benign	Het
Nwd2	T	C	5: 63,805,704	I877T	probably damaging	Het
Olfml2b	A	T	1: 170,681,100	N509I	possibly damaging	Het
Olfr1226	T	C	2: 89,193,887	Y49C	probably benign	Het
Olfr1307	G	C	2: 111,944,728	H243D	probably damaging	Het
Olfr387-ps1	T	C	11: 73,664,645	L12P	probably damaging	Het
Pabpc6	T	C	17: 9,669,403	N73S	probably damaging	Het
Parp12	A	G	6: 39,089,050	F580L	probably benign	Het
Parvg	C	A	15: 84,328,959	H80Q	probably damaging	Het
Pcdhb14	T	C	18: 37,449,488	V549A	probably damaging	Het
Pde8b	T	A	13: 95,043,026	H374L	probably benign	Het
Phf2	C	T	13: 48,817,505		probably benign	Het
Pld4	T	C	12: 112,763,490	F69L	probably benign	Het
Qrich2	T	C	11: 116,456,630	I1123V	unknown	Het
Rida	C	T	15: 34,495,096	V8M	possibly damaging	Het
Rnf19b	T	A	4: 129,058,685	C139S	probably damaging	Het
Rp1	T	C	1: 4,024,868	I1254M	unknown	Het
Rpl3l	A	G	17: 24,728,473	T2A	possibly damaging	Het
Serpinb6e	A	T	13: 33,838,959	I147N	possibly damaging	Het
Slc12a4	G	A	8: 105,946,758	T727I	probably damaging	Het
Slc25a16	C	T	10: 62,928,340	R59*	probably null	Het
Tbc1d5	TTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTG	17: 50,799,934		probably benign	Het
Tll1	T	A	8: 64,085,465	T382S	probably damaging	Het
Tmem246	T	C	4: 49,587,067	T34A	possibly damaging	Het
Tmprss6	T	A	15: 78,444,128	D556V	probably damaging	Het
Ttc13	A	G	8: 124,674,360		probably null	Het
Ttc30a1	C	A	2: 75,981,554	E62*	probably null	Het
Usp43	T	A	11: 67,876,418	K709*	probably null	Het
Vcan	A	T	13: 89,692,111	N1771K	possibly damaging	Het
Zfyve16	T	C	13: 92,523,161	I81V	probably benign	Het
Zxdc	A	G	6: 90,370,004	T116A	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGACAGCTGTGCTAGGAG -3'
(R):5'- ACAACCTTTCTTGGGACGCC -3'

Sequencing Primer
(F):5'- CTGTGCTAGGAGGGGGTTG -3'
(R):5'- AGCACTGGGTTTTCTATCTGGATCAC -3'

Posted On

2021-04-30