Incidental Mutation 'R8792:Strc'
ID 670981
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Name stereocilin
Synonyms DFNB16
MMRRC Submission
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R8792 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121363728-121387168 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121377805 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 362 (I362F)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: I362F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: I362F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
I830077J02Rik T C 3: 105,927,788 probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
R8874:Strc UTSW 2 121374872 critical splice donor site probably null
R8947:Strc UTSW 2 121370989 missense probably benign 0.09
R9285:Strc UTSW 2 121364798 missense probably damaging 1.00
R9302:Strc UTSW 2 121380855 missense unknown
R9386:Strc UTSW 2 121367730 missense probably damaging 0.99
R9438:Strc UTSW 2 121368166 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGACAGCTGTGCTAGGAG -3'
(R):5'- ACAACCTTTCTTGGGACGCC -3'

Sequencing Primer
(F):5'- CTGTGCTAGGAGGGGGTTG -3'
(R):5'- AGCACTGGGTTTTCTATCTGGATCAC -3'
Posted On 2021-04-30