Incidental Mutation 'R8792:Ttc13'
ID 671001
Institutional Source Beutler Lab
Gene Symbol Ttc13
Ensembl Gene ENSMUSG00000037300
Gene Name tetratricopeptide repeat domain 13
Synonyms MGC:28881
MMRRC Submission
Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8792 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 124671332-124721983 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 124674360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]
AlphaFold A0A1L1SSC7
Predicted Effect probably null
Transcript: ENSMUST00000041614
SMART Domains Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:TPR_11 153 204 3e-8 PFAM
Pfam:TPR_19 154 213 5.1e-8 PFAM
Pfam:TPR_1 173 206 6.1e-10 PFAM
Pfam:TPR_2 173 206 1.2e-7 PFAM
Pfam:TPR_8 173 206 5.2e-8 PFAM
Pfam:TPR_16 177 241 6.5e-11 PFAM
Pfam:TPR_9 179 249 3.5e-6 PFAM
Pfam:TPR_11 204 272 2.2e-8 PFAM
Pfam:TPR_1 207 240 3.3e-5 PFAM
Pfam:TPR_2 207 240 1.9e-5 PFAM
Blast:UTG 692 755 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117624
SMART Domains Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 161 2e-13 BLAST
TPR 162 194 1.08e1 SMART
TPR 195 228 2.24e-7 SMART
TPR 229 262 3.67e-3 SMART
Blast:UTG 714 777 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118134
SMART Domains Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 156 4e-10 BLAST
TPR 181 214 5.56e-3 SMART
TPR 215 248 1.17e-1 SMART
TPR 249 282 2.24e-7 SMART
TPR 283 316 3.67e-3 SMART
Blast:UTG 768 831 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000214828
Predicted Effect probably benign
Transcript: ENSMUST00000231984
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (62/62)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
I830077J02Rik T C 3: 105,927,788 probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Ttc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc13 APN 8 124688847 splice site probably benign
IGL01086:Ttc13 APN 8 124675346 missense probably damaging 0.98
IGL01411:Ttc13 APN 8 124683285 missense probably damaging 1.00
IGL01511:Ttc13 APN 8 124676371 missense probably damaging 1.00
IGL01610:Ttc13 APN 8 124676344 missense probably damaging 1.00
IGL01626:Ttc13 APN 8 124673738 splice site probably benign
IGL01967:Ttc13 APN 8 124712647 missense probably damaging 0.99
IGL01995:Ttc13 APN 8 124688882 missense probably damaging 1.00
IGL02456:Ttc13 APN 8 124690361 critical splice acceptor site probably null
IGL02816:Ttc13 APN 8 124712676 missense possibly damaging 0.89
3-1:Ttc13 UTSW 8 124679009 missense possibly damaging 0.81
LCD18:Ttc13 UTSW 8 124675866 intron probably benign
R0126:Ttc13 UTSW 8 124683291 missense probably damaging 0.99
R0391:Ttc13 UTSW 8 124674401 missense probably damaging 1.00
R0602:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0629:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0638:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0714:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R1981:Ttc13 UTSW 8 124714187 critical splice donor site probably null
R2051:Ttc13 UTSW 8 124672211 splice site probably null
R2324:Ttc13 UTSW 8 124679057 missense probably damaging 1.00
R2404:Ttc13 UTSW 8 124678997 splice site probably benign
R2571:Ttc13 UTSW 8 124683799 missense probably damaging 1.00
R3110:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R3112:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R4560:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4562:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4563:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4565:Ttc13 UTSW 8 124682087 missense probably damaging 1.00
R4855:Ttc13 UTSW 8 124674435 missense probably damaging 1.00
R4998:Ttc13 UTSW 8 124680056 missense probably damaging 1.00
R5137:Ttc13 UTSW 8 124694935 nonsense probably null
R5397:Ttc13 UTSW 8 124675263 missense possibly damaging 0.94
R5619:Ttc13 UTSW 8 124679944 intron probably benign
R5966:Ttc13 UTSW 8 124682220 intron probably benign
R6092:Ttc13 UTSW 8 124679033 missense probably benign 0.36
R6321:Ttc13 UTSW 8 124683191 missense probably damaging 1.00
R6439:Ttc13 UTSW 8 124673482 missense probably benign 0.02
R6737:Ttc13 UTSW 8 124682161 critical splice acceptor site probably null
R6804:Ttc13 UTSW 8 124699687 missense probably damaging 1.00
R6967:Ttc13 UTSW 8 124688618 missense probably benign 0.17
R7542:Ttc13 UTSW 8 124675103 splice site probably null
R7905:Ttc13 UTSW 8 124688596 missense probably benign 0.09
R8769:Ttc13 UTSW 8 124679077 missense possibly damaging 0.71
R8916:Ttc13 UTSW 8 124683237 missense probably damaging 0.96
R8953:Ttc13 UTSW 8 124675349 missense probably damaging 1.00
R9149:Ttc13 UTSW 8 124683300 missense probably benign 0.01
R9151:Ttc13 UTSW 8 124675282 missense probably benign 0.03
R9221:Ttc13 UTSW 8 124673551 missense probably benign 0.20
R9251:Ttc13 UTSW 8 124675253 missense probably benign 0.17
R9502:Ttc13 UTSW 8 124683271 missense possibly damaging 0.93
R9600:Ttc13 UTSW 8 124688545 missense probably benign 0.32
X0027:Ttc13 UTSW 8 124673589 missense probably benign
Z1176:Ttc13 UTSW 8 124694842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAATCCCCTTCATGGTTGGCC -3'
(R):5'- TTTCTAACTAAGCACGCCAGCC -3'

Sequencing Primer
(F):5'- GTCTCCTCAGGGTTACCATTAAAGG -3'
(R):5'- TAAGCACGCCAGCCCTGAG -3'
Posted On 2021-04-30