Incidental Mutation 'R8792:Pld4'
ID671011
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8792 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112763490 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 69 (F69L)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888]
Predicted Effect probably benign
Transcript: ENSMUST00000063888
AA Change: F69L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: F69L

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R0052:Pld4 UTSW 12 112767857 missense probably benign 0.03
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2006:Pld4 UTSW 12 112768489 missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112768558 missense probably damaging 1.00
R3738:Pld4 UTSW 12 112768035 missense probably benign 0.07
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6767:Pld4 UTSW 12 112764115 missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
R7864:Pld4 UTSW 12 112765123 missense probably damaging 1.00
R8826:Pld4 UTSW 12 112766776 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGAGCCTGGACAGTATCTG -3'
(R):5'- CTATACAGTGAGGAACCTGGGG -3'

Sequencing Primer
(F):5'- CCTGGACAGTATCTGTTATAGGACAG -3'
(R):5'- TGGGACAATCACAGCCTTACTG -3'
Posted On2021-04-30