Incidental Mutation 'R8792:Rpl3l'
ID671025
Institutional Source Beutler Lab
Gene Symbol Rpl3l
Ensembl Gene ENSMUSG00000002500
Gene Nameribosomal protein L3-like
Synonyms1110057H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8792 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24727820-24736143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24728473 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2 (T2A)
Ref Sequence ENSEMBL: ENSMUSP00000138489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000045602] [ENSMUST00000135708] [ENSMUST00000170239] [ENSMUST00000183214]
Predicted Effect probably benign
Transcript: ENSMUST00000045186
SMART Domains Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 181 5.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045602
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135708
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170239
AA Change: T54A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.2e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183214
AA Change: T2A

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500
AA Change: T2A

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 133 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Rpl3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Rpl3l APN 17 24735471 missense probably damaging 0.96
IGL01364:Rpl3l APN 17 24732430 missense probably benign 0.07
IGL02009:Rpl3l APN 17 24732433 missense probably damaging 0.98
IGL02422:Rpl3l APN 17 24733988 nonsense probably null
IGL03309:Rpl3l APN 17 24736024 missense possibly damaging 0.64
PIT4468001:Rpl3l UTSW 17 24735483 missense probably benign 0.00
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1782:Rpl3l UTSW 17 24733456 missense probably benign 0.02
R2019:Rpl3l UTSW 17 24735516 unclassified probably benign
R2509:Rpl3l UTSW 17 24732386 missense possibly damaging 0.94
R3844:Rpl3l UTSW 17 24733942 missense probably benign 0.02
R4574:Rpl3l UTSW 17 24734010 missense possibly damaging 0.70
R4675:Rpl3l UTSW 17 24733610 missense probably benign 0.43
R5097:Rpl3l UTSW 17 24733461 missense probably damaging 1.00
R5106:Rpl3l UTSW 17 24732437 missense probably damaging 1.00
R5187:Rpl3l UTSW 17 24732455 missense possibly damaging 0.95
R6073:Rpl3l UTSW 17 24730887 missense probably benign
R6295:Rpl3l UTSW 17 24733992 missense probably benign
R7624:Rpl3l UTSW 17 24732427 missense probably benign
R7655:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7656:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7834:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
R8527:Rpl3l UTSW 17 24735780 missense probably damaging 1.00
R8542:Rpl3l UTSW 17 24735780 missense probably damaging 1.00
R8840:Rpl3l UTSW 17 24733737 missense probably damaging 0.99
R8867:Rpl3l UTSW 17 24735481 missense probably damaging 1.00
Z1177:Rpl3l UTSW 17 24728398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAGTCAACCTGAAGCCAC -3'
(R):5'- CACGAAACCTGACTGTCCTGAG -3'

Sequencing Primer
(F):5'- CACCGCTAGAGAGACTTCAGTTATG -3'
(R):5'- TGACTGTCCTGAGGGCAACAC -3'
Posted On2021-04-30