Incidental Mutation 'R8793:Arfgef1'
ID 671030
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene Name ADP ribosylation factor guanine nucleotide exchange factor 1
Synonyms D730028O18Rik, D130059B05Rik, BIG1, P200, ARFGEP1
MMRRC Submission 068610-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8793 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 10207796-10302895 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 10212832 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1696 (N1696K)
Ref Sequence ENSEMBL: ENSMUSP00000085986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615]
AlphaFold G3X9K3
Predicted Effect possibly damaging
Transcript: ENSMUST00000088615
AA Change: N1696K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: N1696K

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 59,945,804 (GRCm39) D158A probably damaging Het
Acot7 G A 4: 152,284,380 (GRCm39) V17I probably benign Het
Akap13 A G 7: 75,375,076 (GRCm39) T184A probably benign Het
Ankrd31 T A 13: 96,968,221 (GRCm39) D619E probably damaging Het
Arap3 A G 18: 38,107,492 (GRCm39) F1342L probably benign Het
Asap2 A G 12: 21,218,212 (GRCm39) D45G probably damaging Het
Atp8b4 T A 2: 126,231,254 (GRCm39) M456L probably benign Het
Bag5 A T 12: 111,677,355 (GRCm39) I156N possibly damaging Het
Banp T A 8: 122,750,743 (GRCm39) V478E probably benign Het
BC024063 A T 10: 81,945,352 (GRCm39) H324L probably benign Het
Bms1 T A 6: 118,360,784 (GRCm39) K1228M probably damaging Het
Btaf1 A G 19: 36,958,429 (GRCm39) K649E probably benign Het
Cpox C A 16: 58,493,708 (GRCm39) P226Q probably damaging Het
Cux1 A G 5: 136,594,539 (GRCm39) S5P unknown Het
Dock2 G T 11: 34,451,215 (GRCm39) Q837K probably benign Het
Fam171a1 T C 2: 3,187,535 (GRCm39) I134T probably damaging Het
Gm2832 A G 14: 41,003,726 (GRCm39) T186A Het
Gm8246 T C 14: 16,984,554 (GRCm39) E93G probably damaging Het
Grid2ip C T 5: 143,363,396 (GRCm39) T463M probably damaging Het
Mael G A 1: 166,029,257 (GRCm39) R389C probably benign Het
Myo9a C A 9: 59,791,850 (GRCm39) Q1818K probably benign Het
Nwd1 A G 8: 73,419,704 (GRCm39) D963G probably benign Het
Or13c3 A G 4: 52,856,490 (GRCm39) F8L probably benign Het
Or2g1 T C 17: 38,107,255 (GRCm39) S307P probably benign Het
Pappa2 A T 1: 158,678,731 (GRCm39) V895E probably damaging Het
Pcna T C 2: 132,093,193 (GRCm39) T185A probably benign Het
Pip4k2c A G 10: 127,042,530 (GRCm39) F108L probably damaging Het
Pole T A 5: 110,445,614 (GRCm39) S497T probably damaging Het
Potefam3b G A 8: 21,159,053 (GRCm39) V136I probably benign Het
Ppp1r12c A G 7: 4,485,887 (GRCm39) V653A probably benign Het
Pramel27 A G 4: 143,577,627 (GRCm39) probably benign Het
Ryr1 A T 7: 28,764,284 (GRCm39) V3072E probably damaging Het
Sh3bgr G A 16: 96,025,792 (GRCm39) probably null Het
Slc27a5 A C 7: 12,723,296 (GRCm39) L550R probably benign Het
Strip2 C T 6: 29,956,815 (GRCm39) P815S probably benign Het
Tars3 G T 7: 65,294,673 (GRCm39) probably benign Het
Tle5 T C 10: 81,397,152 (GRCm39) probably null Het
Tmem237 G T 1: 59,146,613 (GRCm39) L337M probably damaging Het
Ttn T C 2: 76,555,506 (GRCm39) M30500V probably benign Het
Ube2u T C 4: 100,336,416 (GRCm39) F13S probably damaging Het
Ugcg A C 4: 59,207,794 (GRCm39) K44N probably benign Het
Vmn2r39 A T 7: 9,028,149 (GRCm39) H407Q probably damaging Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10,270,012 (GRCm39) missense probably benign
IGL00919:Arfgef1 APN 1 10,243,462 (GRCm39) missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10,244,301 (GRCm39) missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10,269,207 (GRCm39) splice site probably benign
IGL01288:Arfgef1 APN 1 10,283,436 (GRCm39) missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10,229,796 (GRCm39) missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10,223,657 (GRCm39) missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10,230,133 (GRCm39) nonsense probably null
IGL01669:Arfgef1 APN 1 10,229,840 (GRCm39) missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10,217,753 (GRCm39) missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10,224,621 (GRCm39) missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10,283,338 (GRCm39) missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10,270,108 (GRCm39) missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10,279,893 (GRCm39) missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10,243,067 (GRCm39) missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10,251,275 (GRCm39) splice site probably benign
IGL02743:Arfgef1 APN 1 10,270,054 (GRCm39) missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10,224,543 (GRCm39) missense probably damaging 1.00
Collected UTSW 1 10,251,163 (GRCm39) missense probably damaging 1.00
uncle_joe UTSW 1 10,231,060 (GRCm39) missense probably damaging 1.00
G1Funyon:Arfgef1 UTSW 1 10,250,058 (GRCm39) missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10,243,478 (GRCm39) missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10,243,478 (GRCm39) missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10,269,067 (GRCm39) critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10,250,212 (GRCm39) splice site probably benign
R0636:Arfgef1 UTSW 1 10,270,076 (GRCm39) missense probably benign
R1006:Arfgef1 UTSW 1 10,210,706 (GRCm39) missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10,286,784 (GRCm39) missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10,254,315 (GRCm39) missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10,229,958 (GRCm39) missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10,243,164 (GRCm39) missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10,259,509 (GRCm39) missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10,230,184 (GRCm39) missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10,275,115 (GRCm39) missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10,243,480 (GRCm39) missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10,275,115 (GRCm39) missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10,275,115 (GRCm39) missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10,275,115 (GRCm39) missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10,258,977 (GRCm39) splice site probably null
R2146:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10,270,103 (GRCm39) missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10,244,367 (GRCm39) missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10,223,879 (GRCm39) missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10,212,811 (GRCm39) frame shift probably null
R3916:Arfgef1 UTSW 1 10,259,668 (GRCm39) missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10,212,811 (GRCm39) frame shift probably null
R3949:Arfgef1 UTSW 1 10,212,811 (GRCm39) frame shift probably null
R3977:Arfgef1 UTSW 1 10,279,859 (GRCm39) missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10,279,859 (GRCm39) missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10,279,859 (GRCm39) missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10,233,984 (GRCm39) missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10,229,861 (GRCm39) missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10,229,771 (GRCm39) intron probably benign
R4572:Arfgef1 UTSW 1 10,283,366 (GRCm39) missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10,243,487 (GRCm39) missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10,212,891 (GRCm39) missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10,259,836 (GRCm39) missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10,223,958 (GRCm39) missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10,286,772 (GRCm39) missense probably benign
R4898:Arfgef1 UTSW 1 10,229,798 (GRCm39) missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10,283,334 (GRCm39) missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10,269,961 (GRCm39) missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10,275,132 (GRCm39) missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10,231,060 (GRCm39) missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10,269,952 (GRCm39) critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10,231,201 (GRCm39) missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10,214,971 (GRCm39) missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10,259,085 (GRCm39) missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10,231,063 (GRCm39) missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10,229,808 (GRCm39) missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10,209,109 (GRCm39) missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10,279,753 (GRCm39) missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10,230,964 (GRCm39) missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10,251,163 (GRCm39) missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10,243,146 (GRCm39) missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10,259,036 (GRCm39) missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10,283,285 (GRCm39) missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10,264,621 (GRCm39) missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10,259,677 (GRCm39) missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10,223,904 (GRCm39) missense probably damaging 0.99
R6967:Arfgef1 UTSW 1 10,223,903 (GRCm39) missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10,223,904 (GRCm39) missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10,223,903 (GRCm39) missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10,223,904 (GRCm39) missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10,223,903 (GRCm39) missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10,223,904 (GRCm39) missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10,223,903 (GRCm39) missense probably damaging 1.00
R7092:Arfgef1 UTSW 1 10,223,901 (GRCm39) missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10,269,200 (GRCm39) missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10,254,685 (GRCm39) missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10,251,122 (GRCm39) missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10,302,694 (GRCm39) missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10,264,636 (GRCm39) missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10,264,636 (GRCm39) missense possibly damaging 0.78
R7772:Arfgef1 UTSW 1 10,227,235 (GRCm39) missense possibly damaging 0.96
R7968:Arfgef1 UTSW 1 10,243,145 (GRCm39) missense probably damaging 1.00
R8195:Arfgef1 UTSW 1 10,243,478 (GRCm39) missense probably damaging 1.00
R8292:Arfgef1 UTSW 1 10,227,194 (GRCm39) missense probably benign 0.06
R8301:Arfgef1 UTSW 1 10,250,058 (GRCm39) missense probably damaging 1.00
R8341:Arfgef1 UTSW 1 10,224,553 (GRCm39) missense probably benign 0.37
R8410:Arfgef1 UTSW 1 10,229,867 (GRCm39) missense possibly damaging 0.94
R8411:Arfgef1 UTSW 1 10,286,759 (GRCm39) missense probably benign 0.01
R8903:Arfgef1 UTSW 1 10,211,838 (GRCm39) missense probably damaging 1.00
R8955:Arfgef1 UTSW 1 10,270,062 (GRCm39) missense probably benign 0.25
R9036:Arfgef1 UTSW 1 10,259,055 (GRCm39) missense probably benign 0.01
R9185:Arfgef1 UTSW 1 10,215,004 (GRCm39) missense probably damaging 1.00
R9252:Arfgef1 UTSW 1 10,243,122 (GRCm39) nonsense probably null
R9333:Arfgef1 UTSW 1 10,222,037 (GRCm39) nonsense probably null
R9335:Arfgef1 UTSW 1 10,228,236 (GRCm39) missense probably damaging 1.00
R9348:Arfgef1 UTSW 1 10,283,419 (GRCm39) missense probably benign 0.03
R9355:Arfgef1 UTSW 1 10,270,000 (GRCm39) missense probably benign 0.00
R9564:Arfgef1 UTSW 1 10,217,758 (GRCm39) missense probably benign 0.00
R9600:Arfgef1 UTSW 1 10,233,977 (GRCm39) missense probably benign 0.01
R9789:Arfgef1 UTSW 1 10,243,427 (GRCm39) missense probably damaging 1.00
V1662:Arfgef1 UTSW 1 10,243,478 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCTGAGGACTCTCTTC -3'
(R):5'- AGGGATCGTTGAGTCTTCAGTTTAC -3'

Sequencing Primer
(F):5'- AGGACTCTCTTCTATGAGTAGGCAC -3'
(R):5'- TCGTTGAGTCTTCAGTTTACTAAAAC -3'
Posted On 2021-04-30