Incidental Mutation 'R8793:Fam171a1'
ID 671034
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R8793 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3186498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 134 (I134T)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably damaging
Transcript: ENSMUST00000062934
AA Change: I129T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: I129T

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072955
AA Change: I9T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: I9T

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091505
AA Change: I134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530
AA Change: I134T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115099
AA Change: I134T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: I134T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,383 D158A probably damaging Het
Acot7 G A 4: 152,199,923 V17I probably benign Het
Aes T C 10: 81,561,318 probably null Het
Akap13 A G 7: 75,725,328 T184A probably benign Het
Ankrd31 T A 13: 96,831,713 D619E probably damaging Het
Arap3 A G 18: 37,974,439 F1342L probably benign Het
Arfgef1 G C 1: 10,142,607 N1696K possibly damaging Het
Asap2 A G 12: 21,168,211 D45G probably damaging Het
Atp8b4 T A 2: 126,389,334 M456L probably benign Het
Bag5 A T 12: 111,710,921 I156N possibly damaging Het
Banp T A 8: 122,024,004 V478E probably benign Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Bms1 T A 6: 118,383,823 K1228M probably damaging Het
Btaf1 A G 19: 36,981,029 K649E probably benign Het
Cpox C A 16: 58,673,345 P226Q probably damaging Het
Cux1 A G 5: 136,565,685 S5P unknown Het
Dock2 G T 11: 34,501,215 Q837K probably benign Het
Gm13103 A G 4: 143,851,057 probably benign Het
Gm21119 G A 8: 20,619,037 V136I probably benign Het
Gm2832 A G 14: 41,281,769 T186A Het
Gm8246 T C 14: 5,476,822 E93G probably damaging Het
Grid2ip C T 5: 143,377,641 T463M probably damaging Het
Mael G A 1: 166,201,688 R389C probably benign Het
Myo9a C A 9: 59,884,567 Q1818K probably benign Het
Nwd1 A G 8: 72,693,076 D963G probably benign Het
Olfr123 T C 17: 37,796,364 S307P probably benign Het
Olfr273 A G 4: 52,856,490 F8L probably benign Het
Pappa2 A T 1: 158,851,161 V895E probably damaging Het
Pcna T C 2: 132,251,273 T185A probably benign Het
Pip4k2c A G 10: 127,206,661 F108L probably damaging Het
Pole T A 5: 110,297,748 S497T probably damaging Het
Ppp1r12c A G 7: 4,482,888 V653A probably benign Het
Ryr1 A T 7: 29,064,859 V3072E probably damaging Het
Sh3bgr G A 16: 96,224,592 probably null Het
Slc27a5 A C 7: 12,989,369 L550R probably benign Het
Strip2 C T 6: 29,956,816 P815S probably benign Het
Tarsl2 G T 7: 65,644,925 probably benign Het
Tmem237 G T 1: 59,107,454 L337M probably damaging Het
Ttn T C 2: 76,725,162 M30500V probably benign Het
Ube2u T C 4: 100,479,219 F13S probably damaging Het
Ugcg A C 4: 59,207,794 K44N probably benign Het
Vmn2r39 A T 7: 9,025,150 H407Q probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GATTCCAGTACTGCCATTTCG -3'
(R):5'- AAATGCAGACTTCTCACAGGG -3'

Sequencing Primer
(F):5'- CAGTACTGCCATTTCGCTAATC -3'
(R):5'- GACTTCTCACAGGGGCAAC -3'
Posted On 2021-04-30