Incidental Mutation 'R8793:Fam171a1'
ID 671034
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms 9630050M13Rik
MMRRC Submission 068610-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R8793 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3115261-3228843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3187535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 134 (I134T)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably damaging
Transcript: ENSMUST00000062934
AA Change: I129T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: I129T

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072955
AA Change: I9T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: I9T

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091505
AA Change: I134T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530
AA Change: I134T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115099
AA Change: I134T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: I134T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 59,945,804 (GRCm39) D158A probably damaging Het
Acot7 G A 4: 152,284,380 (GRCm39) V17I probably benign Het
Akap13 A G 7: 75,375,076 (GRCm39) T184A probably benign Het
Ankrd31 T A 13: 96,968,221 (GRCm39) D619E probably damaging Het
Arap3 A G 18: 38,107,492 (GRCm39) F1342L probably benign Het
Arfgef1 G C 1: 10,212,832 (GRCm39) N1696K possibly damaging Het
Asap2 A G 12: 21,218,212 (GRCm39) D45G probably damaging Het
Atp8b4 T A 2: 126,231,254 (GRCm39) M456L probably benign Het
Bag5 A T 12: 111,677,355 (GRCm39) I156N possibly damaging Het
Banp T A 8: 122,750,743 (GRCm39) V478E probably benign Het
BC024063 A T 10: 81,945,352 (GRCm39) H324L probably benign Het
Bms1 T A 6: 118,360,784 (GRCm39) K1228M probably damaging Het
Btaf1 A G 19: 36,958,429 (GRCm39) K649E probably benign Het
Cpox C A 16: 58,493,708 (GRCm39) P226Q probably damaging Het
Cux1 A G 5: 136,594,539 (GRCm39) S5P unknown Het
Dock2 G T 11: 34,451,215 (GRCm39) Q837K probably benign Het
Gm2832 A G 14: 41,003,726 (GRCm39) T186A Het
Gm8246 T C 14: 16,984,554 (GRCm39) E93G probably damaging Het
Grid2ip C T 5: 143,363,396 (GRCm39) T463M probably damaging Het
Mael G A 1: 166,029,257 (GRCm39) R389C probably benign Het
Myo9a C A 9: 59,791,850 (GRCm39) Q1818K probably benign Het
Nwd1 A G 8: 73,419,704 (GRCm39) D963G probably benign Het
Or13c3 A G 4: 52,856,490 (GRCm39) F8L probably benign Het
Or2g1 T C 17: 38,107,255 (GRCm39) S307P probably benign Het
Pappa2 A T 1: 158,678,731 (GRCm39) V895E probably damaging Het
Pcna T C 2: 132,093,193 (GRCm39) T185A probably benign Het
Pip4k2c A G 10: 127,042,530 (GRCm39) F108L probably damaging Het
Pole T A 5: 110,445,614 (GRCm39) S497T probably damaging Het
Potefam3b G A 8: 21,159,053 (GRCm39) V136I probably benign Het
Ppp1r12c A G 7: 4,485,887 (GRCm39) V653A probably benign Het
Pramel27 A G 4: 143,577,627 (GRCm39) probably benign Het
Ryr1 A T 7: 28,764,284 (GRCm39) V3072E probably damaging Het
Sh3bgr G A 16: 96,025,792 (GRCm39) probably null Het
Slc27a5 A C 7: 12,723,296 (GRCm39) L550R probably benign Het
Strip2 C T 6: 29,956,815 (GRCm39) P815S probably benign Het
Tars3 G T 7: 65,294,673 (GRCm39) probably benign Het
Tle5 T C 10: 81,397,152 (GRCm39) probably null Het
Tmem237 G T 1: 59,146,613 (GRCm39) L337M probably damaging Het
Ttn T C 2: 76,555,506 (GRCm39) M30500V probably benign Het
Ube2u T C 4: 100,336,416 (GRCm39) F13S probably damaging Het
Ugcg A C 4: 59,207,794 (GRCm39) K44N probably benign Het
Vmn2r39 A T 7: 9,028,149 (GRCm39) H407Q probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3,179,327 (GRCm39) missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3,203,657 (GRCm39) missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3,203,663 (GRCm39) missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3,224,623 (GRCm39) critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3,224,527 (GRCm39) missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3,203,612 (GRCm39) missense possibly damaging 0.83
ghosted UTSW 2 3,226,189 (GRCm39) nonsense probably null
R0167:Fam171a1 UTSW 2 3,187,469 (GRCm39) missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0468:Fam171a1 UTSW 2 3,226,433 (GRCm39) missense probably benign
R0811:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3,198,464 (GRCm39) missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3,226,354 (GRCm39) missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3,226,660 (GRCm39) missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3,179,410 (GRCm39) missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3,227,189 (GRCm39) missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3,221,380 (GRCm39) missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3,226,656 (GRCm39) nonsense probably null
R2355:Fam171a1 UTSW 2 3,226,570 (GRCm39) nonsense probably null
R3690:Fam171a1 UTSW 2 3,227,393 (GRCm39) missense probably benign
R3723:Fam171a1 UTSW 2 3,221,412 (GRCm39) splice site probably benign
R3978:Fam171a1 UTSW 2 3,226,072 (GRCm39) missense probably benign
R4087:Fam171a1 UTSW 2 3,227,333 (GRCm39) missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3,221,328 (GRCm39) missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3,225,946 (GRCm39) missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3,224,550 (GRCm39) missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3,226,615 (GRCm39) missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3,224,546 (GRCm39) missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3,179,505 (GRCm39) splice site probably null
R5137:Fam171a1 UTSW 2 3,226,426 (GRCm39) missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3,224,582 (GRCm39) missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3,179,390 (GRCm39) missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3,226,654 (GRCm39) missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3,226,334 (GRCm39) missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3,227,126 (GRCm39) missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3,226,374 (GRCm39) missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3,227,392 (GRCm39) missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3,224,512 (GRCm39) missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3,226,189 (GRCm39) nonsense probably null
R7155:Fam171a1 UTSW 2 3,226,766 (GRCm39) missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3,119,653 (GRCm39) missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3,227,509 (GRCm39) nonsense probably null
R7477:Fam171a1 UTSW 2 3,226,676 (GRCm39) missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3,221,391 (GRCm39) missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3,226,483 (GRCm39) missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3,179,354 (GRCm39) missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3,226,421 (GRCm39) missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3,179,298 (GRCm39) missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3,221,352 (GRCm39) missense probably damaging 0.98
R8850:Fam171a1 UTSW 2 3,221,344 (GRCm39) missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3,226,940 (GRCm39) missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3,227,434 (GRCm39) missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3,226,525 (GRCm39) missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3,224,543 (GRCm39) missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3,226,037 (GRCm39) missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3,226,630 (GRCm39) missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3,225,971 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GATTCCAGTACTGCCATTTCG -3'
(R):5'- AAATGCAGACTTCTCACAGGG -3'

Sequencing Primer
(F):5'- CAGTACTGCCATTTCGCTAATC -3'
(R):5'- GACTTCTCACAGGGGCAAC -3'
Posted On 2021-04-30