Incidental Mutation 'R8793:Bms1'
ID 671047
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene Name BMS1, ribosome biogenesis factor
Synonyms Bms1l
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8793 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 118383381-118419474 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118383823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 1228 (K1228M)
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237]
AlphaFold Q6PGF5
Predicted Effect probably damaging
Transcript: ENSMUST00000032237
AA Change: K1228M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138
AA Change: K1228M

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,383 D158A probably damaging Het
Acot7 G A 4: 152,199,923 V17I probably benign Het
Aes T C 10: 81,561,318 probably null Het
Akap13 A G 7: 75,725,328 T184A probably benign Het
Ankrd31 T A 13: 96,831,713 D619E probably damaging Het
Arap3 A G 18: 37,974,439 F1342L probably benign Het
Arfgef1 G C 1: 10,142,607 N1696K possibly damaging Het
Asap2 A G 12: 21,168,211 D45G probably damaging Het
Atp8b4 T A 2: 126,389,334 M456L probably benign Het
Bag5 A T 12: 111,710,921 I156N possibly damaging Het
Banp T A 8: 122,024,004 V478E probably benign Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Btaf1 A G 19: 36,981,029 K649E probably benign Het
Cpox C A 16: 58,673,345 P226Q probably damaging Het
Cux1 A G 5: 136,565,685 S5P unknown Het
Dock2 G T 11: 34,501,215 Q837K probably benign Het
Fam171a1 T C 2: 3,186,498 I134T probably damaging Het
Gm13103 A G 4: 143,851,057 probably benign Het
Gm21119 G A 8: 20,619,037 V136I probably benign Het
Gm2832 A G 14: 41,281,769 T186A Het
Gm8246 T C 14: 5,476,822 E93G probably damaging Het
Grid2ip C T 5: 143,377,641 T463M probably damaging Het
Mael G A 1: 166,201,688 R389C probably benign Het
Myo9a C A 9: 59,884,567 Q1818K probably benign Het
Nwd1 A G 8: 72,693,076 D963G probably benign Het
Olfr123 T C 17: 37,796,364 S307P probably benign Het
Olfr273 A G 4: 52,856,490 F8L probably benign Het
Pappa2 A T 1: 158,851,161 V895E probably damaging Het
Pcna T C 2: 132,251,273 T185A probably benign Het
Pip4k2c A G 10: 127,206,661 F108L probably damaging Het
Pole T A 5: 110,297,748 S497T probably damaging Het
Ppp1r12c A G 7: 4,482,888 V653A probably benign Het
Ryr1 A T 7: 29,064,859 V3072E probably damaging Het
Sh3bgr G A 16: 96,224,592 probably null Het
Slc27a5 A C 7: 12,989,369 L550R probably benign Het
Strip2 C T 6: 29,956,816 P815S probably benign Het
Tarsl2 G T 7: 65,644,925 probably benign Het
Tmem237 G T 1: 59,107,454 L337M probably damaging Het
Ttn T C 2: 76,725,162 M30500V probably benign Het
Ube2u T C 4: 100,479,219 F13S probably damaging Het
Ugcg A C 4: 59,207,794 K44N probably benign Het
Vmn2r39 A T 7: 9,025,150 H407Q probably damaging Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R0556:Bms1 UTSW 6 118413179 missense probably damaging 1.00
R1078:Bms1 UTSW 6 118405221 missense probably benign 0.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4293:Bms1 UTSW 6 118405347 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5327:Bms1 UTSW 6 118405218 missense possibly damaging 0.53
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5511:Bms1 UTSW 6 118388887 missense possibly damaging 0.85
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense probably benign
R8068:Bms1 UTSW 6 118413750 missense probably damaging 1.00
R8098:Bms1 UTSW 6 118384258 missense probably damaging 0.98
R8176:Bms1 UTSW 6 118418450 missense probably damaging 1.00
R8424:Bms1 UTSW 6 118388760 missense probably benign 0.24
R8728:Bms1 UTSW 6 118392370 missense possibly damaging 0.93
R8970:Bms1 UTSW 6 118392331 missense possibly damaging 0.92
R9234:Bms1 UTSW 6 118398083 missense probably damaging 0.96
R9440:Bms1 UTSW 6 118405256 missense probably benign
R9701:Bms1 UTSW 6 118391186 missense probably damaging 0.98
R9802:Bms1 UTSW 6 118391186 missense probably damaging 0.98
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGGTATCCTCAGCTCCTCTCAG -3'
(R):5'- TAAGGAGTAACGACCCCTGTC -3'

Sequencing Primer
(F):5'- CTCAGACTAGACTTCTGACTTCG -3'
(R):5'- AGTAACGACCCCTGTCTGGTG -3'
Posted On 2021-04-30