Incidental Mutation 'R8794:Cdc42bpa'
ID 671078
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene Name CDC42 binding protein kinase alpha
Synonyms A930014J19Rik, DMPK-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 179960472-180165603 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 180067251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 332 (N332I)
Ref Sequence ENSEMBL: ENSMUSP00000106746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]
AlphaFold Q3UU96
Predicted Effect probably damaging
Transcript: ENSMUST00000076687
AA Change: N332I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: N332I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097450
AA Change: N332I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: N332I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097453
AA Change: N332I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: N332I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111117
AA Change: N332I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: N332I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134959
SMART Domains Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
PDB:4AW2|A 2 90 1e-58 PDB
SCOP:d1koba_ 50 90 7e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212756
AA Change: N332I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,107 V498D unknown Het
Actn1 C T 12: 80,198,980 probably benign Het
Actrt2 T C 4: 154,666,719 E320G probably damaging Het
Adamts7 C T 9: 90,194,186 Q1265* probably null Het
Adra1a A G 14: 66,637,615 N13S probably benign Het
Alpk3 G T 7: 81,057,655 R9L unknown Het
Ankrd42 A G 7: 92,614,466 F225L probably benign Het
C3 T C 17: 57,221,011 E736G probably benign Het
Ccng1 A G 11: 40,753,999 S24P probably benign Het
Cep131 G A 11: 120,081,248 P90S probably benign Het
Chd8 A G 14: 52,204,447 S2154P probably damaging Het
Cilp A G 9: 65,279,253 S877G probably benign Het
Clic6 T A 16: 92,528,099 S382T possibly damaging Het
Coq8a G T 1: 180,179,208 P85Q probably benign Het
Creb3l4 A G 3: 90,237,918 I309T probably benign Het
Cux2 T C 5: 121,869,243 E785G probably benign Het
Cyfip2 A G 11: 46,253,973 F685L possibly damaging Het
Epha6 T C 16: 60,205,672 D469G probably benign Het
Erc1 A T 6: 119,630,655 V962E probably damaging Het
Esrrb A T 12: 86,470,264 S57C probably damaging Het
Fam169a A G 13: 97,114,120 T320A possibly damaging Het
Farsb C T 1: 78,425,041 probably benign Het
Frem3 T C 8: 80,612,278 V400A probably damaging Het
Frem3 A T 8: 80,616,222 M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 T786A probably benign Het
Gapvd1 A T 2: 34,704,318 S886T possibly damaging Het
Gba2 A G 4: 43,568,077 S737P probably damaging Het
Gm4869 A G 5: 140,476,030 E529G probably damaging Het
Gm525 A G 11: 89,088,653 N85S probably damaging Het
Gnpda1 T A 18: 38,332,038 D175V probably benign Het
Heatr5b T C 17: 78,815,586 I655V probably benign Het
Hmcn1 G A 1: 150,715,718 T1910I probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ier2 A T 8: 84,662,467 D95E probably damaging Het
Ifi208 A G 1: 173,695,804 R547G possibly damaging Het
Itih3 T A 14: 30,912,897 S639C possibly damaging Het
March7 G A 2: 60,243,671 probably null Het
Mep1b A C 18: 21,091,268 T373P probably damaging Het
Mlh3 G A 12: 85,235,723 P1379S probably damaging Het
Nav3 T A 10: 109,769,171 K1014* probably null Het
Nme1 A T 11: 93,960,832 F78I probably benign Het
Nos3 T A 5: 24,371,747 V458D probably damaging Het
Noxa1 A G 2: 25,094,840 F29L probably benign Het
Nrcam G A 12: 44,578,175 G1055D probably benign Het
Nutf2 A T 8: 105,875,539 probably benign Het
Olfr1218 T C 2: 89,055,133 M98V probably benign Het
Olfr1272 A T 2: 90,281,806 Y256* probably null Het
Olfr506 A T 7: 108,612,373 D22V probably benign Het
Olfr869 A T 9: 20,137,334 M73L possibly damaging Het
Oog3 A G 4: 144,157,986 I460T probably benign Het
Pde2a A T 7: 101,505,929 Y559F possibly damaging Het
Pde6d G A 1: 86,547,487 Q61* probably null Het
Pdpr A G 8: 111,125,608 T536A possibly damaging Het
Pias4 T A 10: 81,164,012 K69M probably damaging Het
Pigo A T 4: 43,023,787 D188E possibly damaging Het
Pik3r2 A G 8: 70,771,363 V270A probably benign Het
Plod2 T A 9: 92,600,748 W456R probably damaging Het
Pmpcb T C 5: 21,756,834 V450A probably benign Het
Poln G A 5: 34,129,527 T99I possibly damaging Het
Prg2 A G 2: 84,982,060 D38G possibly damaging Het
Psmd7 A C 8: 107,584,199 Y138D probably damaging Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Ranbp2 T A 10: 58,492,592 V2810E probably damaging Het
Rgma A T 7: 73,417,900 H411L probably damaging Het
Sapcd1 T C 17: 35,027,838 T25A probably damaging Het
Serpinb6e T C 13: 33,840,994 I105V possibly damaging Het
Serpinb9f A T 13: 33,329,413 T158S probably benign Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Skint6 A T 4: 113,192,672 S265R possibly damaging Het
Slc23a2 A T 2: 132,060,709 F524L probably benign Het
Slc2a13 C A 15: 91,350,099 G345C probably damaging Het
Sp110 A G 1: 85,583,510 probably null Het
Srcin1 A G 11: 97,548,977 V109A probably benign Het
Tfcp2l1 A G 1: 118,632,388 N70S probably damaging Het
Tmem30c T A 16: 57,270,190 H218L probably benign Het
Tmprss11d G A 5: 86,338,821 T70I probably damaging Het
Tnpo2 A T 8: 85,038,485 Q32L probably benign Het
Trav16n A C 14: 53,351,410 T48P probably damaging Het
Ufc1 A G 1: 171,289,522 Y110H probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Xirp2 A T 2: 67,511,213 E1266V probably damaging Het
Zfp423 A C 8: 87,781,229 L829R probably damaging Het
Zfp735 A G 11: 73,712,203 K658E possibly damaging Het
Zscan12 T A 13: 21,363,677 C10S possibly damaging Het
Zswim3 T A 2: 164,820,767 M389K probably damaging Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 180031560 missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1547:Cdc42bpa UTSW 1 180074644 missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 180109194 missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 180144635 missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7670:Cdc42bpa UTSW 1 180065081 missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 180069319 missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 180162125 missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 180162144 missense probably damaging 0.98
R8835:Cdc42bpa UTSW 1 180069351 missense probably damaging 1.00
R8896:Cdc42bpa UTSW 1 180130808 intron probably benign
R9012:Cdc42bpa UTSW 1 180031512 missense
R9110:Cdc42bpa UTSW 1 180117693 missense possibly damaging 0.67
R9178:Cdc42bpa UTSW 1 180130836 missense
R9184:Cdc42bpa UTSW 1 180144736 missense probably benign 0.13
R9204:Cdc42bpa UTSW 1 180111895 critical splice donor site probably null
R9227:Cdc42bpa UTSW 1 180106073 missense probably benign
R9230:Cdc42bpa UTSW 1 180106073 missense probably benign
R9299:Cdc42bpa UTSW 1 180144508 missense probably damaging 1.00
R9366:Cdc42bpa UTSW 1 180094110 missense probably damaging 1.00
R9381:Cdc42bpa UTSW 1 180141483 missense probably damaging 0.97
R9461:Cdc42bpa UTSW 1 180142296 missense probably damaging 1.00
R9559:Cdc42bpa UTSW 1 180111894 critical splice donor site probably null
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCACTGCTAAGTCATCAAAC -3'
(R):5'- GCAGGACAGGACATCTTCATAATG -3'

Sequencing Primer
(F):5'- GTAGACACTTTTCTAAGGGAAATGC -3'
(R):5'- GACAGGACATCTTCATAATGTCATAC -3'
Posted On 2021-04-30