Incidental Mutation 'R8794:Creb3l4'
ID 671090
Institutional Source Beutler Lab
Gene Symbol Creb3l4
Ensembl Gene ENSMUSG00000027938
Gene Name cAMP responsive element binding protein 3-like 4
Synonyms Tisp40alpha, JAL, Tisp40beta, Tisp40, 1700012K17Rik, 5330432F22Rik, mJAL, ATCE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90237500-90243512 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90237918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 309 (I309T)
Ref Sequence ENSEMBL: ENSMUSP00000029547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029546] [ENSMUST00000029547] [ENSMUST00000107369] [ENSMUST00000119304]
AlphaFold Q9D2A5
Predicted Effect probably benign
Transcript: ENSMUST00000029546
SMART Domains Protein: ENSMUSP00000029546
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:JTB 37 143 5.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029547
AA Change: I309T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: I309T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107369
AA Change: I309T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: I309T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119304
SMART Domains Protein: ENSMUSP00000113763
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:JTB 30 95 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: This gene encodes a CREB (cyclic AMP-responsive element-binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein may play a role in adiposity and male germ cell development. Homozygous knockout mice for this gene show increased adipogenesis, elevated testicular germ cell apoptosis and defects in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display oligozoospermia but have normal fertility and sperm morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,107 V498D unknown Het
Actn1 C T 12: 80,198,980 probably benign Het
Actrt2 T C 4: 154,666,719 E320G probably damaging Het
Adamts7 C T 9: 90,194,186 Q1265* probably null Het
Adra1a A G 14: 66,637,615 N13S probably benign Het
Alpk3 G T 7: 81,057,655 R9L unknown Het
Ankrd42 A G 7: 92,614,466 F225L probably benign Het
C3 T C 17: 57,221,011 E736G probably benign Het
Ccng1 A G 11: 40,753,999 S24P probably benign Het
Cdc42bpa A T 1: 180,067,251 N332I probably damaging Het
Cep131 G A 11: 120,081,248 P90S probably benign Het
Chd8 A G 14: 52,204,447 S2154P probably damaging Het
Cilp A G 9: 65,279,253 S877G probably benign Het
Clic6 T A 16: 92,528,099 S382T possibly damaging Het
Coq8a G T 1: 180,179,208 P85Q probably benign Het
Cux2 T C 5: 121,869,243 E785G probably benign Het
Cyfip2 A G 11: 46,253,973 F685L possibly damaging Het
Epha6 T C 16: 60,205,672 D469G probably benign Het
Erc1 A T 6: 119,630,655 V962E probably damaging Het
Esrrb A T 12: 86,470,264 S57C probably damaging Het
Fam169a A G 13: 97,114,120 T320A possibly damaging Het
Farsb C T 1: 78,425,041 probably benign Het
Frem3 T C 8: 80,612,278 V400A probably damaging Het
Frem3 A T 8: 80,616,222 M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 T786A probably benign Het
Gapvd1 A T 2: 34,704,318 S886T possibly damaging Het
Gba2 A G 4: 43,568,077 S737P probably damaging Het
Gm4869 A G 5: 140,476,030 E529G probably damaging Het
Gm525 A G 11: 89,088,653 N85S probably damaging Het
Gnpda1 T A 18: 38,332,038 D175V probably benign Het
Heatr5b T C 17: 78,815,586 I655V probably benign Het
Hmcn1 G A 1: 150,715,718 T1910I probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ier2 A T 8: 84,662,467 D95E probably damaging Het
Ifi208 A G 1: 173,695,804 R547G possibly damaging Het
Itih3 T A 14: 30,912,897 S639C possibly damaging Het
March7 G A 2: 60,243,671 probably null Het
Mep1b A C 18: 21,091,268 T373P probably damaging Het
Mlh3 G A 12: 85,235,723 P1379S probably damaging Het
Nav3 T A 10: 109,769,171 K1014* probably null Het
Nme1 A T 11: 93,960,832 F78I probably benign Het
Nos3 T A 5: 24,371,747 V458D probably damaging Het
Noxa1 A G 2: 25,094,840 F29L probably benign Het
Nrcam G A 12: 44,578,175 G1055D probably benign Het
Nutf2 A T 8: 105,875,539 probably benign Het
Olfr1218 T C 2: 89,055,133 M98V probably benign Het
Olfr1272 A T 2: 90,281,806 Y256* probably null Het
Olfr506 A T 7: 108,612,373 D22V probably benign Het
Olfr869 A T 9: 20,137,334 M73L possibly damaging Het
Oog3 A G 4: 144,157,986 I460T probably benign Het
Pde2a A T 7: 101,505,929 Y559F possibly damaging Het
Pde6d G A 1: 86,547,487 Q61* probably null Het
Pdpr A G 8: 111,125,608 T536A possibly damaging Het
Pias4 T A 10: 81,164,012 K69M probably damaging Het
Pigo A T 4: 43,023,787 D188E possibly damaging Het
Pik3r2 A G 8: 70,771,363 V270A probably benign Het
Plod2 T A 9: 92,600,748 W456R probably damaging Het
Pmpcb T C 5: 21,756,834 V450A probably benign Het
Poln G A 5: 34,129,527 T99I possibly damaging Het
Prg2 A G 2: 84,982,060 D38G possibly damaging Het
Psmd7 A C 8: 107,584,199 Y138D probably damaging Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Ranbp2 T A 10: 58,492,592 V2810E probably damaging Het
Rgma A T 7: 73,417,900 H411L probably damaging Het
Sapcd1 T C 17: 35,027,838 T25A probably damaging Het
Serpinb6e T C 13: 33,840,994 I105V possibly damaging Het
Serpinb9f A T 13: 33,329,413 T158S probably benign Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Skint6 A T 4: 113,192,672 S265R possibly damaging Het
Slc23a2 A T 2: 132,060,709 F524L probably benign Het
Slc2a13 C A 15: 91,350,099 G345C probably damaging Het
Sp110 A G 1: 85,583,510 probably null Het
Srcin1 A G 11: 97,548,977 V109A probably benign Het
Tfcp2l1 A G 1: 118,632,388 N70S probably damaging Het
Tmem30c T A 16: 57,270,190 H218L probably benign Het
Tmprss11d G A 5: 86,338,821 T70I probably damaging Het
Tnpo2 A T 8: 85,038,485 Q32L probably benign Het
Trav16n A C 14: 53,351,410 T48P probably damaging Het
Ufc1 A G 1: 171,289,522 Y110H probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Xirp2 A T 2: 67,511,213 E1266V probably damaging Het
Zfp423 A C 8: 87,781,229 L829R probably damaging Het
Zfp735 A G 11: 73,712,203 K658E possibly damaging Het
Zscan12 T A 13: 21,363,677 C10S possibly damaging Het
Zswim3 T A 2: 164,820,767 M389K probably damaging Het
Other mutations in Creb3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Creb3l4 APN 3 90241987 missense possibly damaging 0.95
IGL01015:Creb3l4 APN 3 90242831 start codon destroyed probably null
IGL01092:Creb3l4 APN 3 90237738 missense probably damaging 1.00
IGL02172:Creb3l4 APN 3 90242775 missense probably benign 0.21
IGL02291:Creb3l4 APN 3 90241983 missense probably benign 0.03
R1344:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1418:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1836:Creb3l4 UTSW 3 90238903 missense probably benign 0.26
R2154:Creb3l4 UTSW 3 90238485 missense probably damaging 1.00
R2877:Creb3l4 UTSW 3 90242308 missense probably damaging 0.99
R4923:Creb3l4 UTSW 3 90242214 missense probably benign 0.00
R6024:Creb3l4 UTSW 3 90238699 missense probably damaging 1.00
R6683:Creb3l4 UTSW 3 90237805 missense probably benign 0.08
R7567:Creb3l4 UTSW 3 90242422 missense probably benign 0.00
R8749:Creb3l4 UTSW 3 90237892 missense probably benign
Z1088:Creb3l4 UTSW 3 90237751 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCCTGCCACATGATAAAAG -3'
(R):5'- AATCAGAAGCTAGGCCCGAG -3'

Sequencing Primer
(F):5'- CCCTGCCACATGATAAAAGGTGATAG -3'
(R):5'- CCCGAGGATTATCAGCTTCATGGAG -3'
Posted On 2021-04-30