Incidental Mutation 'R8794:Skint6'
ID 671095
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 068723-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113049869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 265 (S265R)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: S265R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: S265R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: S265R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: S265R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,226,939 (GRCm39) V498D unknown Het
Actn1 C T 12: 80,245,754 (GRCm39) probably benign Het
Actrt2 T C 4: 154,751,176 (GRCm39) E320G probably damaging Het
Adamts7 C T 9: 90,076,239 (GRCm39) Q1265* probably null Het
Adra1a A G 14: 66,875,064 (GRCm39) N13S probably benign Het
Alpk3 G T 7: 80,707,403 (GRCm39) R9L unknown Het
Ankrd42 A G 7: 92,263,674 (GRCm39) F225L probably benign Het
C3 T C 17: 57,528,011 (GRCm39) E736G probably benign Het
Ccng1 A G 11: 40,644,826 (GRCm39) S24P probably benign Het
Cdc42bpa A T 1: 179,894,816 (GRCm39) N332I probably damaging Het
Cep131 G A 11: 119,972,074 (GRCm39) P90S probably benign Het
Chd8 A G 14: 52,441,904 (GRCm39) S2154P probably damaging Het
Cilp A G 9: 65,186,535 (GRCm39) S877G probably benign Het
Clic6 T A 16: 92,324,987 (GRCm39) S382T possibly damaging Het
Coq8a G T 1: 180,006,773 (GRCm39) P85Q probably benign Het
Creb3l4 A G 3: 90,145,225 (GRCm39) I309T probably benign Het
Cux2 T C 5: 122,007,306 (GRCm39) E785G probably benign Het
Cyfip2 A G 11: 46,144,800 (GRCm39) F685L possibly damaging Het
Epha6 T C 16: 60,026,035 (GRCm39) D469G probably benign Het
Erc1 A T 6: 119,607,616 (GRCm39) V962E probably damaging Het
Esrrb A T 12: 86,517,038 (GRCm39) S57C probably damaging Het
Fam169a A G 13: 97,250,628 (GRCm39) T320A possibly damaging Het
Farsb C T 1: 78,401,678 (GRCm39) probably benign Het
Frem3 T C 8: 81,338,907 (GRCm39) V400A probably damaging Het
Frem3 A T 8: 81,342,851 (GRCm39) M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 (GRCm39) T786A probably benign Het
Gapvd1 A T 2: 34,594,330 (GRCm39) S886T possibly damaging Het
Gba2 A G 4: 43,568,077 (GRCm39) S737P probably damaging Het
Gm525 A G 11: 88,979,479 (GRCm39) N85S probably damaging Het
Gnpda1 T A 18: 38,465,091 (GRCm39) D175V probably benign Het
Heatr5b T C 17: 79,123,015 (GRCm39) I655V probably benign Het
Hmcn1 G A 1: 150,591,469 (GRCm39) T1910I probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Ier2 A T 8: 85,389,096 (GRCm39) D95E probably damaging Het
Ifi208 A G 1: 173,523,370 (GRCm39) R547G possibly damaging Het
Itih3 T A 14: 30,634,854 (GRCm39) S639C possibly damaging Het
Kif19b A G 5: 140,461,785 (GRCm39) E529G probably damaging Het
Marchf7 G A 2: 60,074,015 (GRCm39) probably null Het
Mep1b A C 18: 21,224,325 (GRCm39) T373P probably damaging Het
Mlh3 G A 12: 85,282,497 (GRCm39) P1379S probably damaging Het
Nav3 T A 10: 109,605,032 (GRCm39) K1014* probably null Het
Nme1 A T 11: 93,851,658 (GRCm39) F78I probably benign Het
Nos3 T A 5: 24,576,745 (GRCm39) V458D probably damaging Het
Noxa1 A G 2: 24,984,852 (GRCm39) F29L probably benign Het
Nrcam G A 12: 44,624,958 (GRCm39) G1055D probably benign Het
Nutf2 A T 8: 106,602,171 (GRCm39) probably benign Het
Oog3 A G 4: 143,884,556 (GRCm39) I460T probably benign Het
Or4b1b A T 2: 90,112,150 (GRCm39) Y256* probably null Het
Or4c113 T C 2: 88,885,477 (GRCm39) M98V probably benign Het
Or5p78 A T 7: 108,211,580 (GRCm39) D22V probably benign Het
Or7e175 A T 9: 20,048,630 (GRCm39) M73L possibly damaging Het
Pde2a A T 7: 101,155,136 (GRCm39) Y559F possibly damaging Het
Pde6d G A 1: 86,475,209 (GRCm39) Q61* probably null Het
Pdpr A G 8: 111,852,240 (GRCm39) T536A possibly damaging Het
Pias4 T A 10: 80,999,846 (GRCm39) K69M probably damaging Het
Pigo A T 4: 43,023,787 (GRCm39) D188E possibly damaging Het
Pik3r2 A G 8: 71,224,007 (GRCm39) V270A probably benign Het
Plod2 T A 9: 92,482,801 (GRCm39) W456R probably damaging Het
Pmpcb T C 5: 21,961,832 (GRCm39) V450A probably benign Het
Poln G A 5: 34,286,871 (GRCm39) T99I possibly damaging Het
Prg2 A G 2: 84,812,404 (GRCm39) D38G possibly damaging Het
Psmd7 A C 8: 108,310,831 (GRCm39) Y138D probably damaging Het
Ptprk T A 10: 28,139,504 (GRCm39) Y76* probably null Het
Ranbp2 T A 10: 58,328,414 (GRCm39) V2810E probably damaging Het
Rgma A T 7: 73,067,648 (GRCm39) H411L probably damaging Het
Sapcd1 T C 17: 35,246,814 (GRCm39) T25A probably damaging Het
Serpinb6e T C 13: 34,024,977 (GRCm39) I105V possibly damaging Het
Serpinb9f A T 13: 33,513,396 (GRCm39) T158S probably benign Het
Sirpb1b T A 3: 15,613,843 (GRCm39) T80S probably benign Het
Slc23a2 A T 2: 131,902,629 (GRCm39) F524L probably benign Het
Slc2a13 C A 15: 91,234,302 (GRCm39) G345C probably damaging Het
Sp110 A G 1: 85,511,231 (GRCm39) probably null Het
Srcin1 A G 11: 97,439,803 (GRCm39) V109A probably benign Het
Tfcp2l1 A G 1: 118,560,118 (GRCm39) N70S probably damaging Het
Tmem30c T A 16: 57,090,553 (GRCm39) H218L probably benign Het
Tmprss11d G A 5: 86,486,680 (GRCm39) T70I probably damaging Het
Tnpo2 A T 8: 85,765,114 (GRCm39) Q32L probably benign Het
Trav16n A C 14: 53,588,867 (GRCm39) T48P probably damaging Het
Ufc1 A G 1: 171,117,095 (GRCm39) Y110H probably damaging Het
Wars2 A G 3: 99,123,888 (GRCm39) K250E probably damaging Het
Wdfy4 G T 14: 32,869,049 (GRCm39) N326K probably benign Het
Xirp2 A T 2: 67,341,557 (GRCm39) E1266V probably damaging Het
Zfp423 A C 8: 88,507,857 (GRCm39) L829R probably damaging Het
Zfp735 A G 11: 73,603,029 (GRCm39) K658E possibly damaging Het
Zscan12 T A 13: 21,547,847 (GRCm39) C10S possibly damaging Het
Zswim3 T A 2: 164,662,687 (GRCm39) M389K probably damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGAAATCAAGGTTTCATAAGCTCAT -3'
(R):5'- AAGCACTGCCATTGGGACA -3'

Sequencing Primer
(F):5'- TGACTGTTGATCAAGAAAAGCTG -3'
(R):5'- GGACCTAGCTGAAGGACTCAC -3'
Posted On 2021-04-30