Mutagenetix > Incidental Mutation

Incidental Mutation 'R8794:Skint6'

671095

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R8794 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113192672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 265 (S265R)

Ref Sequence

ENSEMBL: ENSMUSP00000121870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138966
AA Change: S265R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: S265R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171224
AA Change: S265R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: S265R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

100% (86/86)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	A	17: 9,008,107	V498D	unknown	Het
Actn1	C	T	12: 80,198,980		probably benign	Het
Actrt2	T	C	4: 154,666,719	E320G	probably damaging	Het
Adamts7	C	T	9: 90,194,186	Q1265*	probably null	Het
Adra1a	A	G	14: 66,637,615	N13S	probably benign	Het
Alpk3	G	T	7: 81,057,655	R9L	unknown	Het
Ankrd42	A	G	7: 92,614,466	F225L	probably benign	Het
C3	T	C	17: 57,221,011	E736G	probably benign	Het
Ccng1	A	G	11: 40,753,999	S24P	probably benign	Het
Cdc42bpa	A	T	1: 180,067,251	N332I	probably damaging	Het
Cep131	G	A	11: 120,081,248	P90S	probably benign	Het
Chd8	A	G	14: 52,204,447	S2154P	probably damaging	Het
Cilp	A	G	9: 65,279,253	S877G	probably benign	Het
Clic6	T	A	16: 92,528,099	S382T	possibly damaging	Het
Coq8a	G	T	1: 180,179,208	P85Q	probably benign	Het
Creb3l4	A	G	3: 90,237,918	I309T	probably benign	Het
Cux2	T	C	5: 121,869,243	E785G	probably benign	Het
Cyfip2	A	G	11: 46,253,973	F685L	possibly damaging	Het
Epha6	T	C	16: 60,205,672	D469G	probably benign	Het
Erc1	A	T	6: 119,630,655	V962E	probably damaging	Het
Esrrb	A	T	12: 86,470,264	S57C	probably damaging	Het
Fam169a	A	G	13: 97,114,120	T320A	possibly damaging	Het
Farsb	C	T	1: 78,425,041		probably benign	Het
Frem3	T	C	8: 80,612,278	V400A	probably damaging	Het
Frem3	A	T	8: 80,616,222	M1715L	probably benign	Het
Frmpd1	A	G	4: 45,279,632	T786A	probably benign	Het
Gapvd1	A	T	2: 34,704,318	S886T	possibly damaging	Het
Gba2	A	G	4: 43,568,077	S737P	probably damaging	Het
Gm4869	A	G	5: 140,476,030	E529G	probably damaging	Het
Gm525	A	G	11: 89,088,653	N85S	probably damaging	Het
Gnpda1	T	A	18: 38,332,038	D175V	probably benign	Het
Heatr5b	T	C	17: 78,815,586	I655V	probably benign	Het
Hmcn1	G	A	1: 150,715,718	T1910I	probably benign	Het
Idh1	CA	CAA	1: 65,165,188		probably null	Het
Ier2	A	T	8: 84,662,467	D95E	probably damaging	Het
Ifi208	A	G	1: 173,695,804	R547G	possibly damaging	Het
Itih3	T	A	14: 30,912,897	S639C	possibly damaging	Het
March7	G	A	2: 60,243,671		probably null	Het
Mep1b	A	C	18: 21,091,268	T373P	probably damaging	Het
Mlh3	G	A	12: 85,235,723	P1379S	probably damaging	Het
Nav3	T	A	10: 109,769,171	K1014*	probably null	Het
Nme1	A	T	11: 93,960,832	F78I	probably benign	Het
Nos3	T	A	5: 24,371,747	V458D	probably damaging	Het
Noxa1	A	G	2: 25,094,840	F29L	probably benign	Het
Nrcam	G	A	12: 44,578,175	G1055D	probably benign	Het
Nutf2	A	T	8: 105,875,539		probably benign	Het
Olfr1218	T	C	2: 89,055,133	M98V	probably benign	Het
Olfr1272	A	T	2: 90,281,806	Y256*	probably null	Het
Olfr506	A	T	7: 108,612,373	D22V	probably benign	Het
Olfr869	A	T	9: 20,137,334	M73L	possibly damaging	Het
Oog3	A	G	4: 144,157,986	I460T	probably benign	Het
Pde2a	A	T	7: 101,505,929	Y559F	possibly damaging	Het
Pde6d	G	A	1: 86,547,487	Q61*	probably null	Het
Pdpr	A	G	8: 111,125,608	T536A	possibly damaging	Het
Pias4	T	A	10: 81,164,012	K69M	probably damaging	Het
Pigo	A	T	4: 43,023,787	D188E	possibly damaging	Het
Pik3r2	A	G	8: 70,771,363	V270A	probably benign	Het
Plod2	T	A	9: 92,600,748	W456R	probably damaging	Het
Pmpcb	T	C	5: 21,756,834	V450A	probably benign	Het
Poln	G	A	5: 34,129,527	T99I	possibly damaging	Het
Prg2	A	G	2: 84,982,060	D38G	possibly damaging	Het
Psmd7	A	C	8: 107,584,199	Y138D	probably damaging	Het
Ptprk	T	A	10: 28,263,508	Y76*	probably null	Het
Ranbp2	T	A	10: 58,492,592	V2810E	probably damaging	Het
Rgma	A	T	7: 73,417,900	H411L	probably damaging	Het
Sapcd1	T	C	17: 35,027,838	T25A	probably damaging	Het
Serpinb6e	T	C	13: 33,840,994	I105V	possibly damaging	Het
Serpinb9f	A	T	13: 33,329,413	T158S	probably benign	Het
Sirpb1b	T	A	3: 15,548,783	T80S	probably benign	Het
Slc23a2	A	T	2: 132,060,709	F524L	probably benign	Het
Slc2a13	C	A	15: 91,350,099	G345C	probably damaging	Het
Sp110	A	G	1: 85,583,510		probably null	Het
Srcin1	A	G	11: 97,548,977	V109A	probably benign	Het
Tfcp2l1	A	G	1: 118,632,388	N70S	probably damaging	Het
Tmem30c	T	A	16: 57,270,190	H218L	probably benign	Het
Tmprss11d	G	A	5: 86,338,821	T70I	probably damaging	Het
Tnpo2	A	T	8: 85,038,485	Q32L	probably benign	Het
Trav16n	A	C	14: 53,351,410	T48P	probably damaging	Het
Ufc1	A	G	1: 171,289,522	Y110H	probably damaging	Het
Wars2	A	G	3: 99,216,572	K250E	probably damaging	Het
Wdfy4	G	T	14: 33,147,092	N326K	probably benign	Het
Xirp2	A	T	2: 67,511,213	E1266V	probably damaging	Het
Zfp423	A	C	8: 87,781,229	L829R	probably damaging	Het
Zfp735	A	G	11: 73,712,203	K658E	possibly damaging	Het
Zscan12	T	A	13: 21,363,677	C10S	possibly damaging	Het
Zswim3	T	A	2: 164,820,767	M389K	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGAAATCAAGGTTTCATAAGCTCAT -3'
(R):5'- AAGCACTGCCATTGGGACA -3'

Sequencing Primer
(F):5'- TGACTGTTGATCAAGAAAAGCTG -3'
(R):5'- GGACCTAGCTGAAGGACTCAC -3'

Posted On

2021-04-30