Incidental Mutation 'R8794:Erc1'
ID 671104
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene Name ELKS/RAB6-interacting/CAST family member 1
Synonyms 9630025C19Rik, Elks1, 5033405M01Rik, RAB6IP2B, B430107L16Rik, Rab6ip2, RAB6IP2A
MMRRC Submission 068723-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 119547757-119825128 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119607616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 962 (V962E)
Ref Sequence ENSEMBL: ENSMUSP00000032279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032279
AA Change: V962E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: V962E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183703
AA Change: V962E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: V962E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183880
AA Change: V890E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: V890E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183911
AA Change: V930E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: V930E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184320
AA Change: V226E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000184838
AA Change: V918E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: V918E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184864
AA Change: V958E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: V958E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185139
AA Change: V934E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: V934E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185143
AA Change: V662E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: V662E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,226,939 (GRCm39) V498D unknown Het
Actn1 C T 12: 80,245,754 (GRCm39) probably benign Het
Actrt2 T C 4: 154,751,176 (GRCm39) E320G probably damaging Het
Adamts7 C T 9: 90,076,239 (GRCm39) Q1265* probably null Het
Adra1a A G 14: 66,875,064 (GRCm39) N13S probably benign Het
Alpk3 G T 7: 80,707,403 (GRCm39) R9L unknown Het
Ankrd42 A G 7: 92,263,674 (GRCm39) F225L probably benign Het
C3 T C 17: 57,528,011 (GRCm39) E736G probably benign Het
Ccng1 A G 11: 40,644,826 (GRCm39) S24P probably benign Het
Cdc42bpa A T 1: 179,894,816 (GRCm39) N332I probably damaging Het
Cep131 G A 11: 119,972,074 (GRCm39) P90S probably benign Het
Chd8 A G 14: 52,441,904 (GRCm39) S2154P probably damaging Het
Cilp A G 9: 65,186,535 (GRCm39) S877G probably benign Het
Clic6 T A 16: 92,324,987 (GRCm39) S382T possibly damaging Het
Coq8a G T 1: 180,006,773 (GRCm39) P85Q probably benign Het
Creb3l4 A G 3: 90,145,225 (GRCm39) I309T probably benign Het
Cux2 T C 5: 122,007,306 (GRCm39) E785G probably benign Het
Cyfip2 A G 11: 46,144,800 (GRCm39) F685L possibly damaging Het
Epha6 T C 16: 60,026,035 (GRCm39) D469G probably benign Het
Esrrb A T 12: 86,517,038 (GRCm39) S57C probably damaging Het
Fam169a A G 13: 97,250,628 (GRCm39) T320A possibly damaging Het
Farsb C T 1: 78,401,678 (GRCm39) probably benign Het
Frem3 T C 8: 81,338,907 (GRCm39) V400A probably damaging Het
Frem3 A T 8: 81,342,851 (GRCm39) M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 (GRCm39) T786A probably benign Het
Gapvd1 A T 2: 34,594,330 (GRCm39) S886T possibly damaging Het
Gba2 A G 4: 43,568,077 (GRCm39) S737P probably damaging Het
Gm525 A G 11: 88,979,479 (GRCm39) N85S probably damaging Het
Gnpda1 T A 18: 38,465,091 (GRCm39) D175V probably benign Het
Heatr5b T C 17: 79,123,015 (GRCm39) I655V probably benign Het
Hmcn1 G A 1: 150,591,469 (GRCm39) T1910I probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Ier2 A T 8: 85,389,096 (GRCm39) D95E probably damaging Het
Ifi208 A G 1: 173,523,370 (GRCm39) R547G possibly damaging Het
Itih3 T A 14: 30,634,854 (GRCm39) S639C possibly damaging Het
Kif19b A G 5: 140,461,785 (GRCm39) E529G probably damaging Het
Marchf7 G A 2: 60,074,015 (GRCm39) probably null Het
Mep1b A C 18: 21,224,325 (GRCm39) T373P probably damaging Het
Mlh3 G A 12: 85,282,497 (GRCm39) P1379S probably damaging Het
Nav3 T A 10: 109,605,032 (GRCm39) K1014* probably null Het
Nme1 A T 11: 93,851,658 (GRCm39) F78I probably benign Het
Nos3 T A 5: 24,576,745 (GRCm39) V458D probably damaging Het
Noxa1 A G 2: 24,984,852 (GRCm39) F29L probably benign Het
Nrcam G A 12: 44,624,958 (GRCm39) G1055D probably benign Het
Nutf2 A T 8: 106,602,171 (GRCm39) probably benign Het
Oog3 A G 4: 143,884,556 (GRCm39) I460T probably benign Het
Or4b1b A T 2: 90,112,150 (GRCm39) Y256* probably null Het
Or4c113 T C 2: 88,885,477 (GRCm39) M98V probably benign Het
Or5p78 A T 7: 108,211,580 (GRCm39) D22V probably benign Het
Or7e175 A T 9: 20,048,630 (GRCm39) M73L possibly damaging Het
Pde2a A T 7: 101,155,136 (GRCm39) Y559F possibly damaging Het
Pde6d G A 1: 86,475,209 (GRCm39) Q61* probably null Het
Pdpr A G 8: 111,852,240 (GRCm39) T536A possibly damaging Het
Pias4 T A 10: 80,999,846 (GRCm39) K69M probably damaging Het
Pigo A T 4: 43,023,787 (GRCm39) D188E possibly damaging Het
Pik3r2 A G 8: 71,224,007 (GRCm39) V270A probably benign Het
Plod2 T A 9: 92,482,801 (GRCm39) W456R probably damaging Het
Pmpcb T C 5: 21,961,832 (GRCm39) V450A probably benign Het
Poln G A 5: 34,286,871 (GRCm39) T99I possibly damaging Het
Prg2 A G 2: 84,812,404 (GRCm39) D38G possibly damaging Het
Psmd7 A C 8: 108,310,831 (GRCm39) Y138D probably damaging Het
Ptprk T A 10: 28,139,504 (GRCm39) Y76* probably null Het
Ranbp2 T A 10: 58,328,414 (GRCm39) V2810E probably damaging Het
Rgma A T 7: 73,067,648 (GRCm39) H411L probably damaging Het
Sapcd1 T C 17: 35,246,814 (GRCm39) T25A probably damaging Het
Serpinb6e T C 13: 34,024,977 (GRCm39) I105V possibly damaging Het
Serpinb9f A T 13: 33,513,396 (GRCm39) T158S probably benign Het
Sirpb1b T A 3: 15,613,843 (GRCm39) T80S probably benign Het
Skint6 A T 4: 113,049,869 (GRCm39) S265R possibly damaging Het
Slc23a2 A T 2: 131,902,629 (GRCm39) F524L probably benign Het
Slc2a13 C A 15: 91,234,302 (GRCm39) G345C probably damaging Het
Sp110 A G 1: 85,511,231 (GRCm39) probably null Het
Srcin1 A G 11: 97,439,803 (GRCm39) V109A probably benign Het
Tfcp2l1 A G 1: 118,560,118 (GRCm39) N70S probably damaging Het
Tmem30c T A 16: 57,090,553 (GRCm39) H218L probably benign Het
Tmprss11d G A 5: 86,486,680 (GRCm39) T70I probably damaging Het
Tnpo2 A T 8: 85,765,114 (GRCm39) Q32L probably benign Het
Trav16n A C 14: 53,588,867 (GRCm39) T48P probably damaging Het
Ufc1 A G 1: 171,117,095 (GRCm39) Y110H probably damaging Het
Wars2 A G 3: 99,123,888 (GRCm39) K250E probably damaging Het
Wdfy4 G T 14: 32,869,049 (GRCm39) N326K probably benign Het
Xirp2 A T 2: 67,341,557 (GRCm39) E1266V probably damaging Het
Zfp423 A C 8: 88,507,857 (GRCm39) L829R probably damaging Het
Zfp735 A G 11: 73,603,029 (GRCm39) K658E possibly damaging Het
Zscan12 T A 13: 21,547,847 (GRCm39) C10S possibly damaging Het
Zswim3 T A 2: 164,662,687 (GRCm39) M389K probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119,699,264 (GRCm39) missense probably damaging 0.96
IGL01345:Erc1 APN 6 119,738,224 (GRCm39) nonsense probably null
IGL01370:Erc1 APN 6 119,801,426 (GRCm39) missense probably damaging 1.00
IGL01443:Erc1 APN 6 119,801,432 (GRCm39) missense probably damaging 1.00
IGL01550:Erc1 APN 6 119,760,355 (GRCm39) missense probably damaging 0.96
IGL01798:Erc1 APN 6 119,597,298 (GRCm39) missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119,607,570 (GRCm39) missense probably damaging 1.00
IGL02239:Erc1 APN 6 119,750,852 (GRCm39) missense probably damaging 0.96
IGL02341:Erc1 APN 6 119,571,934 (GRCm39) missense possibly damaging 0.92
couch UTSW 6 119,720,390 (GRCm39) missense possibly damaging 0.81
divan UTSW 6 119,730,249 (GRCm39) missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119,756,452 (GRCm39) missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119,801,791 (GRCm39) missense probably damaging 1.00
R0277:Erc1 UTSW 6 119,597,289 (GRCm39) missense probably damaging 1.00
R0323:Erc1 UTSW 6 119,597,289 (GRCm39) missense probably damaging 1.00
R1053:Erc1 UTSW 6 119,773,887 (GRCm39) missense probably damaging 1.00
R1252:Erc1 UTSW 6 119,720,353 (GRCm39) missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119,720,381 (GRCm39) nonsense probably null
R1470:Erc1 UTSW 6 119,671,563 (GRCm39) missense probably damaging 1.00
R1470:Erc1 UTSW 6 119,671,563 (GRCm39) missense probably damaging 1.00
R1680:Erc1 UTSW 6 119,552,722 (GRCm39) missense probably damaging 1.00
R1833:Erc1 UTSW 6 119,720,390 (GRCm39) missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119,774,266 (GRCm39) missense probably damaging 1.00
R2037:Erc1 UTSW 6 119,699,216 (GRCm39) missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119,552,656 (GRCm39) missense probably damaging 1.00
R3751:Erc1 UTSW 6 119,801,921 (GRCm39) missense probably damaging 0.99
R4473:Erc1 UTSW 6 119,825,417 (GRCm39) splice site probably null
R4778:Erc1 UTSW 6 119,774,298 (GRCm39) splice site probably null
R4897:Erc1 UTSW 6 119,754,947 (GRCm39) critical splice donor site probably null
R5260:Erc1 UTSW 6 119,738,120 (GRCm39) missense probably damaging 1.00
R5382:Erc1 UTSW 6 119,738,233 (GRCm39) missense probably benign 0.02
R5405:Erc1 UTSW 6 119,801,905 (GRCm39) missense probably damaging 1.00
R5801:Erc1 UTSW 6 119,750,783 (GRCm39) missense probably damaging 0.99
R6341:Erc1 UTSW 6 119,754,959 (GRCm39) missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119,552,687 (GRCm39) missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119,801,912 (GRCm39) missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119,571,907 (GRCm39) nonsense probably null
R7532:Erc1 UTSW 6 119,756,592 (GRCm39) missense probably benign 0.02
R7575:Erc1 UTSW 6 119,801,721 (GRCm39) missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119,801,721 (GRCm39) missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119,801,564 (GRCm39) missense probably benign 0.33
R7740:Erc1 UTSW 6 119,738,149 (GRCm39) missense probably benign 0.02
R7789:Erc1 UTSW 6 119,750,670 (GRCm39) nonsense probably null
R7805:Erc1 UTSW 6 119,690,732 (GRCm39) missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119,801,447 (GRCm39) nonsense probably null
R8039:Erc1 UTSW 6 119,750,626 (GRCm39) nonsense probably null
R8229:Erc1 UTSW 6 119,730,249 (GRCm39) missense probably benign 0.27
R8363:Erc1 UTSW 6 119,730,260 (GRCm39) missense probably benign 0.00
R9067:Erc1 UTSW 6 119,774,036 (GRCm39) missense possibly damaging 0.84
R9172:Erc1 UTSW 6 119,801,842 (GRCm39) missense possibly damaging 0.72
R9617:Erc1 UTSW 6 119,773,902 (GRCm39) missense probably benign 0.14
R9744:Erc1 UTSW 6 119,720,360 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCAGAGACCTGTTATGTGTC -3'
(R):5'- TTCCTGCCACCCCGTAAAATG -3'

Sequencing Primer
(F):5'- ATGTCTGAAAGGGCTGAG -3'
(R):5'- TGCCACCCCGTAAAATGATATAAAAC -3'
Posted On 2021-04-30