Incidental Mutation 'R8794:Alpk3'
ID 671106
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 81057600-81105612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 81057655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 9 (R9L)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000107348
AA Change: R9L
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: R9L

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Meta Mutation Damage Score 0.2554 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,107 V498D unknown Het
Actn1 C T 12: 80,198,980 probably benign Het
Actrt2 T C 4: 154,666,719 E320G probably damaging Het
Adamts7 C T 9: 90,194,186 Q1265* probably null Het
Adra1a A G 14: 66,637,615 N13S probably benign Het
Ankrd42 A G 7: 92,614,466 F225L probably benign Het
C3 T C 17: 57,221,011 E736G probably benign Het
Ccng1 A G 11: 40,753,999 S24P probably benign Het
Cdc42bpa A T 1: 180,067,251 N332I probably damaging Het
Cep131 G A 11: 120,081,248 P90S probably benign Het
Chd8 A G 14: 52,204,447 S2154P probably damaging Het
Cilp A G 9: 65,279,253 S877G probably benign Het
Clic6 T A 16: 92,528,099 S382T possibly damaging Het
Coq8a G T 1: 180,179,208 P85Q probably benign Het
Creb3l4 A G 3: 90,237,918 I309T probably benign Het
Cux2 T C 5: 121,869,243 E785G probably benign Het
Cyfip2 A G 11: 46,253,973 F685L possibly damaging Het
Epha6 T C 16: 60,205,672 D469G probably benign Het
Erc1 A T 6: 119,630,655 V962E probably damaging Het
Esrrb A T 12: 86,470,264 S57C probably damaging Het
Fam169a A G 13: 97,114,120 T320A possibly damaging Het
Farsb C T 1: 78,425,041 probably benign Het
Frem3 T C 8: 80,612,278 V400A probably damaging Het
Frem3 A T 8: 80,616,222 M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 T786A probably benign Het
Gapvd1 A T 2: 34,704,318 S886T possibly damaging Het
Gba2 A G 4: 43,568,077 S737P probably damaging Het
Gm4869 A G 5: 140,476,030 E529G probably damaging Het
Gm525 A G 11: 89,088,653 N85S probably damaging Het
Gnpda1 T A 18: 38,332,038 D175V probably benign Het
Heatr5b T C 17: 78,815,586 I655V probably benign Het
Hmcn1 G A 1: 150,715,718 T1910I probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ier2 A T 8: 84,662,467 D95E probably damaging Het
Ifi208 A G 1: 173,695,804 R547G possibly damaging Het
Itih3 T A 14: 30,912,897 S639C possibly damaging Het
March7 G A 2: 60,243,671 probably null Het
Mep1b A C 18: 21,091,268 T373P probably damaging Het
Mlh3 G A 12: 85,235,723 P1379S probably damaging Het
Nav3 T A 10: 109,769,171 K1014* probably null Het
Nme1 A T 11: 93,960,832 F78I probably benign Het
Nos3 T A 5: 24,371,747 V458D probably damaging Het
Noxa1 A G 2: 25,094,840 F29L probably benign Het
Nrcam G A 12: 44,578,175 G1055D probably benign Het
Nutf2 A T 8: 105,875,539 probably benign Het
Olfr1218 T C 2: 89,055,133 M98V probably benign Het
Olfr1272 A T 2: 90,281,806 Y256* probably null Het
Olfr506 A T 7: 108,612,373 D22V probably benign Het
Olfr869 A T 9: 20,137,334 M73L possibly damaging Het
Oog3 A G 4: 144,157,986 I460T probably benign Het
Pde2a A T 7: 101,505,929 Y559F possibly damaging Het
Pde6d G A 1: 86,547,487 Q61* probably null Het
Pdpr A G 8: 111,125,608 T536A possibly damaging Het
Pias4 T A 10: 81,164,012 K69M probably damaging Het
Pigo A T 4: 43,023,787 D188E possibly damaging Het
Pik3r2 A G 8: 70,771,363 V270A probably benign Het
Plod2 T A 9: 92,600,748 W456R probably damaging Het
Pmpcb T C 5: 21,756,834 V450A probably benign Het
Poln G A 5: 34,129,527 T99I possibly damaging Het
Prg2 A G 2: 84,982,060 D38G possibly damaging Het
Psmd7 A C 8: 107,584,199 Y138D probably damaging Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Ranbp2 T A 10: 58,492,592 V2810E probably damaging Het
Rgma A T 7: 73,417,900 H411L probably damaging Het
Sapcd1 T C 17: 35,027,838 T25A probably damaging Het
Serpinb6e T C 13: 33,840,994 I105V possibly damaging Het
Serpinb9f A T 13: 33,329,413 T158S probably benign Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Skint6 A T 4: 113,192,672 S265R possibly damaging Het
Slc23a2 A T 2: 132,060,709 F524L probably benign Het
Slc2a13 C A 15: 91,350,099 G345C probably damaging Het
Sp110 A G 1: 85,583,510 probably null Het
Srcin1 A G 11: 97,548,977 V109A probably benign Het
Tfcp2l1 A G 1: 118,632,388 N70S probably damaging Het
Tmem30c T A 16: 57,270,190 H218L probably benign Het
Tmprss11d G A 5: 86,338,821 T70I probably damaging Het
Tnpo2 A T 8: 85,038,485 Q32L probably benign Het
Trav16n A C 14: 53,351,410 T48P probably damaging Het
Ufc1 A G 1: 171,289,522 Y110H probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Xirp2 A T 2: 67,511,213 E1266V probably damaging Het
Zfp423 A C 8: 87,781,229 L829R probably damaging Het
Zfp735 A G 11: 73,712,203 K658E possibly damaging Het
Zscan12 T A 13: 21,363,677 C10S possibly damaging Het
Zswim3 T A 2: 164,820,767 M389K probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8246:Alpk3 UTSW 7 81092776 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8457:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8775:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8982:Alpk3 UTSW 7 81099002 missense probably damaging 1.00
R9259:Alpk3 UTSW 7 81093554 missense probably damaging 1.00
R9343:Alpk3 UTSW 7 81092331 missense probably benign 0.27
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGGCATTCACGGAGTTTCTC -3'
(R):5'- TCAGAGTGCTTTTGAGAGCC -3'

Sequencing Primer
(F):5'- CATTCACGGAGTTTCTCTGCAGG -3'
(R):5'- TTTTGAGAGCCTGGCCACAC -3'
Posted On 2021-04-30