Incidental Mutation 'R8794:Frem3'
ID 671111
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene Name Fras1 related extracellular matrix protein 3
Synonyms LOC333315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 80611080-80695356 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80612278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 400 (V400A)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: V400A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: V400A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,107 V498D unknown Het
Actn1 C T 12: 80,198,980 probably benign Het
Actrt2 T C 4: 154,666,719 E320G probably damaging Het
Adamts7 C T 9: 90,194,186 Q1265* probably null Het
Adra1a A G 14: 66,637,615 N13S probably benign Het
Alpk3 G T 7: 81,057,655 R9L unknown Het
Ankrd42 A G 7: 92,614,466 F225L probably benign Het
C3 T C 17: 57,221,011 E736G probably benign Het
Ccng1 A G 11: 40,753,999 S24P probably benign Het
Cdc42bpa A T 1: 180,067,251 N332I probably damaging Het
Cep131 G A 11: 120,081,248 P90S probably benign Het
Chd8 A G 14: 52,204,447 S2154P probably damaging Het
Cilp A G 9: 65,279,253 S877G probably benign Het
Clic6 T A 16: 92,528,099 S382T possibly damaging Het
Coq8a G T 1: 180,179,208 P85Q probably benign Het
Creb3l4 A G 3: 90,237,918 I309T probably benign Het
Cux2 T C 5: 121,869,243 E785G probably benign Het
Cyfip2 A G 11: 46,253,973 F685L possibly damaging Het
Epha6 T C 16: 60,205,672 D469G probably benign Het
Erc1 A T 6: 119,630,655 V962E probably damaging Het
Esrrb A T 12: 86,470,264 S57C probably damaging Het
Fam169a A G 13: 97,114,120 T320A possibly damaging Het
Farsb C T 1: 78,425,041 probably benign Het
Frmpd1 A G 4: 45,279,632 T786A probably benign Het
Gapvd1 A T 2: 34,704,318 S886T possibly damaging Het
Gba2 A G 4: 43,568,077 S737P probably damaging Het
Gm4869 A G 5: 140,476,030 E529G probably damaging Het
Gm525 A G 11: 89,088,653 N85S probably damaging Het
Gnpda1 T A 18: 38,332,038 D175V probably benign Het
Heatr5b T C 17: 78,815,586 I655V probably benign Het
Hmcn1 G A 1: 150,715,718 T1910I probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ier2 A T 8: 84,662,467 D95E probably damaging Het
Ifi208 A G 1: 173,695,804 R547G possibly damaging Het
Itih3 T A 14: 30,912,897 S639C possibly damaging Het
March7 G A 2: 60,243,671 probably null Het
Mep1b A C 18: 21,091,268 T373P probably damaging Het
Mlh3 G A 12: 85,235,723 P1379S probably damaging Het
Nav3 T A 10: 109,769,171 K1014* probably null Het
Nme1 A T 11: 93,960,832 F78I probably benign Het
Nos3 T A 5: 24,371,747 V458D probably damaging Het
Noxa1 A G 2: 25,094,840 F29L probably benign Het
Nrcam G A 12: 44,578,175 G1055D probably benign Het
Nutf2 A T 8: 105,875,539 probably benign Het
Olfr1218 T C 2: 89,055,133 M98V probably benign Het
Olfr1272 A T 2: 90,281,806 Y256* probably null Het
Olfr506 A T 7: 108,612,373 D22V probably benign Het
Olfr869 A T 9: 20,137,334 M73L possibly damaging Het
Oog3 A G 4: 144,157,986 I460T probably benign Het
Pde2a A T 7: 101,505,929 Y559F possibly damaging Het
Pde6d G A 1: 86,547,487 Q61* probably null Het
Pdpr A G 8: 111,125,608 T536A possibly damaging Het
Pias4 T A 10: 81,164,012 K69M probably damaging Het
Pigo A T 4: 43,023,787 D188E possibly damaging Het
Pik3r2 A G 8: 70,771,363 V270A probably benign Het
Plod2 T A 9: 92,600,748 W456R probably damaging Het
Pmpcb T C 5: 21,756,834 V450A probably benign Het
Poln G A 5: 34,129,527 T99I possibly damaging Het
Prg2 A G 2: 84,982,060 D38G possibly damaging Het
Psmd7 A C 8: 107,584,199 Y138D probably damaging Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Ranbp2 T A 10: 58,492,592 V2810E probably damaging Het
Rgma A T 7: 73,417,900 H411L probably damaging Het
Sapcd1 T C 17: 35,027,838 T25A probably damaging Het
Serpinb6e T C 13: 33,840,994 I105V possibly damaging Het
Serpinb9f A T 13: 33,329,413 T158S probably benign Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Skint6 A T 4: 113,192,672 S265R possibly damaging Het
Slc23a2 A T 2: 132,060,709 F524L probably benign Het
Slc2a13 C A 15: 91,350,099 G345C probably damaging Het
Sp110 A G 1: 85,583,510 probably null Het
Srcin1 A G 11: 97,548,977 V109A probably benign Het
Tfcp2l1 A G 1: 118,632,388 N70S probably damaging Het
Tmem30c T A 16: 57,270,190 H218L probably benign Het
Tmprss11d G A 5: 86,338,821 T70I probably damaging Het
Tnpo2 A T 8: 85,038,485 Q32L probably benign Het
Trav16n A C 14: 53,351,410 T48P probably damaging Het
Ufc1 A G 1: 171,289,522 Y110H probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Xirp2 A T 2: 67,511,213 E1266V probably damaging Het
Zfp423 A C 8: 87,781,229 L829R probably damaging Het
Zfp735 A G 11: 73,712,203 K658E possibly damaging Het
Zscan12 T A 13: 21,363,677 C10S possibly damaging Het
Zswim3 T A 2: 164,820,767 M389K probably damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8478:Frem3 UTSW 8 80611558 missense probably damaging 1.00
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80616222 missense probably benign 0.02
R8806:Frem3 UTSW 8 80663435 missense probably benign 0.30
R8833:Frem3 UTSW 8 80612772 missense probably benign 0.29
R8879:Frem3 UTSW 8 80613148 missense probably damaging 0.98
R8897:Frem3 UTSW 8 80612790 missense probably damaging 1.00
R8983:Frem3 UTSW 8 80669246 missense probably damaging 1.00
R9207:Frem3 UTSW 8 80613442 missense possibly damaging 0.73
R9277:Frem3 UTSW 8 80690773 missense probably damaging 0.96
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGACGACCTAGTCTTCAACATTCTC -3'
(R):5'- TGCAAACCTCTGACTGCAAC -3'

Sequencing Primer
(F):5'- ATTCTCAATGTACCCGAGGC -3'
(R):5'- CCTCTGACTGCAACAATTTTTATTTC -3'
Posted On 2021-04-30