Incidental Mutation 'R8794:Adamts7'
ID 671121
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
Synonyms ADAM-TS7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 90163069-90208071 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 90194186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1265 (Q1265*)
Ref Sequence ENSEMBL: ENSMUSP00000115972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
AlphaFold Q68SA9
Predicted Effect probably null
Transcript: ENSMUST00000113059
AA Change: Q1366*
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: Q1366*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113060
AA Change: Q1324*
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: Q1324*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000147250
AA Change: Q1265*
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: Q1265*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167122
AA Change: Q1366*
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: Q1366*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,107 V498D unknown Het
Actn1 C T 12: 80,198,980 probably benign Het
Actrt2 T C 4: 154,666,719 E320G probably damaging Het
Adra1a A G 14: 66,637,615 N13S probably benign Het
Alpk3 G T 7: 81,057,655 R9L unknown Het
Ankrd42 A G 7: 92,614,466 F225L probably benign Het
C3 T C 17: 57,221,011 E736G probably benign Het
Ccng1 A G 11: 40,753,999 S24P probably benign Het
Cdc42bpa A T 1: 180,067,251 N332I probably damaging Het
Cep131 G A 11: 120,081,248 P90S probably benign Het
Chd8 A G 14: 52,204,447 S2154P probably damaging Het
Cilp A G 9: 65,279,253 S877G probably benign Het
Clic6 T A 16: 92,528,099 S382T possibly damaging Het
Coq8a G T 1: 180,179,208 P85Q probably benign Het
Creb3l4 A G 3: 90,237,918 I309T probably benign Het
Cux2 T C 5: 121,869,243 E785G probably benign Het
Cyfip2 A G 11: 46,253,973 F685L possibly damaging Het
Epha6 T C 16: 60,205,672 D469G probably benign Het
Erc1 A T 6: 119,630,655 V962E probably damaging Het
Esrrb A T 12: 86,470,264 S57C probably damaging Het
Fam169a A G 13: 97,114,120 T320A possibly damaging Het
Farsb C T 1: 78,425,041 probably benign Het
Frem3 T C 8: 80,612,278 V400A probably damaging Het
Frem3 A T 8: 80,616,222 M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 T786A probably benign Het
Gapvd1 A T 2: 34,704,318 S886T possibly damaging Het
Gba2 A G 4: 43,568,077 S737P probably damaging Het
Gm4869 A G 5: 140,476,030 E529G probably damaging Het
Gm525 A G 11: 89,088,653 N85S probably damaging Het
Gnpda1 T A 18: 38,332,038 D175V probably benign Het
Heatr5b T C 17: 78,815,586 I655V probably benign Het
Hmcn1 G A 1: 150,715,718 T1910I probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ier2 A T 8: 84,662,467 D95E probably damaging Het
Ifi208 A G 1: 173,695,804 R547G possibly damaging Het
Itih3 T A 14: 30,912,897 S639C possibly damaging Het
March7 G A 2: 60,243,671 probably null Het
Mep1b A C 18: 21,091,268 T373P probably damaging Het
Mlh3 G A 12: 85,235,723 P1379S probably damaging Het
Nav3 T A 10: 109,769,171 K1014* probably null Het
Nme1 A T 11: 93,960,832 F78I probably benign Het
Nos3 T A 5: 24,371,747 V458D probably damaging Het
Noxa1 A G 2: 25,094,840 F29L probably benign Het
Nrcam G A 12: 44,578,175 G1055D probably benign Het
Nutf2 A T 8: 105,875,539 probably benign Het
Olfr1218 T C 2: 89,055,133 M98V probably benign Het
Olfr1272 A T 2: 90,281,806 Y256* probably null Het
Olfr506 A T 7: 108,612,373 D22V probably benign Het
Olfr869 A T 9: 20,137,334 M73L possibly damaging Het
Oog3 A G 4: 144,157,986 I460T probably benign Het
Pde2a A T 7: 101,505,929 Y559F possibly damaging Het
Pde6d G A 1: 86,547,487 Q61* probably null Het
Pdpr A G 8: 111,125,608 T536A possibly damaging Het
Pias4 T A 10: 81,164,012 K69M probably damaging Het
Pigo A T 4: 43,023,787 D188E possibly damaging Het
Pik3r2 A G 8: 70,771,363 V270A probably benign Het
Plod2 T A 9: 92,600,748 W456R probably damaging Het
Pmpcb T C 5: 21,756,834 V450A probably benign Het
Poln G A 5: 34,129,527 T99I possibly damaging Het
Prg2 A G 2: 84,982,060 D38G possibly damaging Het
Psmd7 A C 8: 107,584,199 Y138D probably damaging Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Ranbp2 T A 10: 58,492,592 V2810E probably damaging Het
Rgma A T 7: 73,417,900 H411L probably damaging Het
Sapcd1 T C 17: 35,027,838 T25A probably damaging Het
Serpinb6e T C 13: 33,840,994 I105V possibly damaging Het
Serpinb9f A T 13: 33,329,413 T158S probably benign Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Skint6 A T 4: 113,192,672 S265R possibly damaging Het
Slc23a2 A T 2: 132,060,709 F524L probably benign Het
Slc2a13 C A 15: 91,350,099 G345C probably damaging Het
Sp110 A G 1: 85,583,510 probably null Het
Srcin1 A G 11: 97,548,977 V109A probably benign Het
Tfcp2l1 A G 1: 118,632,388 N70S probably damaging Het
Tmem30c T A 16: 57,270,190 H218L probably benign Het
Tmprss11d G A 5: 86,338,821 T70I probably damaging Het
Tnpo2 A T 8: 85,038,485 Q32L probably benign Het
Trav16n A C 14: 53,351,410 T48P probably damaging Het
Ufc1 A G 1: 171,289,522 Y110H probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Xirp2 A T 2: 67,511,213 E1266V probably damaging Het
Zfp423 A C 8: 87,781,229 L829R probably damaging Het
Zfp735 A G 11: 73,712,203 K658E possibly damaging Het
Zscan12 T A 13: 21,363,677 C10S possibly damaging Het
Zswim3 T A 2: 164,820,767 M389K probably damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90174622 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 splice site probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90191804 splice site probably null
R7110:Adamts7 UTSW 9 90193964 missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90185815 missense probably damaging 1.00
R7239:Adamts7 UTSW 9 90186557 splice site probably null
R7519:Adamts7 UTSW 9 90197079 missense probably benign 0.22
R7608:Adamts7 UTSW 9 90173773 missense possibly damaging 0.68
R7635:Adamts7 UTSW 9 90195245 missense probably damaging 1.00
R7699:Adamts7 UTSW 9 90188739 missense probably damaging 1.00
R8519:Adamts7 UTSW 9 90193557 nonsense probably null
R8680:Adamts7 UTSW 9 90195268 missense probably damaging 1.00
R8743:Adamts7 UTSW 9 90195243 missense probably damaging 0.99
R8784:Adamts7 UTSW 9 90193865 missense probably null 0.00
R8851:Adamts7 UTSW 9 90193110 missense probably benign 0.00
R9025:Adamts7 UTSW 9 90185795 nonsense probably null
R9038:Adamts7 UTSW 9 90174639 missense
R9101:Adamts7 UTSW 9 90189741 critical splice donor site probably null
R9256:Adamts7 UTSW 9 90178165 missense probably damaging 1.00
R9261:Adamts7 UTSW 9 90193344 missense probably benign 0.01
R9385:Adamts7 UTSW 9 90195205 nonsense probably null
R9614:Adamts7 UTSW 9 90195198 missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CCTTTTCCAGCCCAGAACTG -3'
(R):5'- CACTCTCCAAGGATGAACAGGG -3'

Sequencing Primer
(F):5'- TAAAAACTCTGACAATGCCTGGG -3'
(R):5'- AACAGGGCTGTGTCTTGCTC -3'
Posted On 2021-04-30