Incidental Mutation 'R0733:Mcm5'
ID67114
Institutional Source Beutler Lab
Gene Symbol Mcm5
Ensembl Gene ENSMUSG00000005410
Gene Nameminichromosome maintenance complex component 5
SynonymsCdc46, mCD46, Mcmd5
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0733 (G1)
Quality Score95
Status Validated
Chromosome8
Chromosomal Location75109569-75128439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75127248 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 710 (K710R)
Ref Sequence ENSEMBL: ENSMUSP00000148525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164309] [ENSMUST00000212426] [ENSMUST00000212811]
Predicted Effect probably benign
Transcript: ENSMUST00000164309
AA Change: K710R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126135
Gene: ENSMUSG00000005410
AA Change: K710R

DomainStartEndE-ValueType
MCM 133 649 N/A SMART
Blast:MCM 693 734 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211912
Predicted Effect probably benign
Transcript: ENSMUST00000212426
AA Change: K710R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212648
Predicted Effect probably benign
Transcript: ENSMUST00000212811
AA Change: K710R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1167 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the oligameric minichromosome maintenance protein complex. During DNA replication, the complex loads onto chromatin in early G1 and is converted into an active replicative helicase during S phase. It functions to limit DNA synthesis to once per cell cycle. During embryogenesis, the encoded protein is negatively regulated through expression of paired box protein Pax 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Mcm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mcm5 APN 8 75124945 critical splice donor site probably null
IGL00954:Mcm5 APN 8 75110112 missense possibly damaging 0.78
IGL02534:Mcm5 APN 8 75114233 missense probably damaging 1.00
IGL03074:Mcm5 APN 8 75119301 missense possibly damaging 0.94
IGL03176:Mcm5 APN 8 75109853 missense possibly damaging 0.95
IGL03240:Mcm5 APN 8 75115902 missense probably damaging 1.00
PIT4142001:Mcm5 UTSW 8 75127236 missense probably benign
R0133:Mcm5 UTSW 8 75120911 missense probably damaging 1.00
R0138:Mcm5 UTSW 8 75120880 missense probably damaging 1.00
R0226:Mcm5 UTSW 8 75126252 missense possibly damaging 0.90
R1217:Mcm5 UTSW 8 75126291 missense probably benign 0.01
R1601:Mcm5 UTSW 8 75119354 missense possibly damaging 0.87
R1834:Mcm5 UTSW 8 75119273 missense possibly damaging 0.64
R1958:Mcm5 UTSW 8 75121629 missense probably benign 0.34
R3410:Mcm5 UTSW 8 75121644 missense possibly damaging 0.88
R4133:Mcm5 UTSW 8 75115854 missense probably damaging 1.00
R4441:Mcm5 UTSW 8 75112544 missense probably benign 0.39
R5395:Mcm5 UTSW 8 75123026 missense probably benign
R5710:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R5714:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R6075:Mcm5 UTSW 8 75114197 missense probably damaging 1.00
R6093:Mcm5 UTSW 8 75109746 missense probably benign 0.06
R6477:Mcm5 UTSW 8 75112602 missense probably benign 0.36
R6848:Mcm5 UTSW 8 75127290 missense possibly damaging 0.88
R7098:Mcm5 UTSW 8 75120901 missense probably damaging 1.00
R7208:Mcm5 UTSW 8 75121716 critical splice donor site probably null
R7278:Mcm5 UTSW 8 75124859 missense probably benign 0.40
R7552:Mcm5 UTSW 8 75121592 missense probably damaging 0.99
R7701:Mcm5 UTSW 8 75123923 missense probably benign 0.00
Z1177:Mcm5 UTSW 8 75121672 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GAGGGCTACTGATAACATGCACAGG -3'
(R):5'- CCAAAGTACATTTCCAGGGGCTGC -3'

Sequencing Primer
(F):5'- acccaaacaagtgacagcc -3'
(R):5'- AGCATTTCAGGCTTGAGGGT -3'
Posted On2013-09-03