Incidental Mutation 'R0733:Prss54'
ID67115
Institutional Source Beutler Lab
Gene Symbol Prss54
Ensembl Gene ENSMUSG00000048400
Gene Nameprotease, serine 54
Synonyms4931432M23Rik
MMRRC Submission 038914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0733 (G1)
Quality Score181
Status Validated
Chromosome8
Chromosomal Location95559069-95576340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95559740 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 235 (D235G)
Ref Sequence ENSEMBL: ENSMUSP00000058859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041569] [ENSMUST00000052690] [ENSMUST00000180075] [ENSMUST00000213096]
Predicted Effect probably benign
Transcript: ENSMUST00000041569
SMART Domains Protein: ENSMUSP00000049497
Gene: ENSMUSG00000036598

DomainStartEndE-ValueType
coiled coil region 95 139 N/A INTRINSIC
Pfam:DUF4201 178 354 6.2e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000052690
AA Change: D235G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058859
Gene: ENSMUSG00000048400
AA Change: D235G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 28 253 1.88e-15 SMART
low complexity region 348 359 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180075
AA Change: D235G

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137577
Gene: ENSMUSG00000048400
AA Change: D235G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 28 253 1.63e-15 SMART
low complexity region 348 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212513
Predicted Effect possibly damaging
Transcript: ENSMUST00000213096
AA Change: D235G

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative serine-type endopeptidase containing the peptidase S1 domain. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nlrp4d T A 7: 10,382,522 E144V probably benign Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Prss54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02340:Prss54 APN 8 95565609 missense probably benign 0.17
IGL02598:Prss54 APN 8 95565709 missense probably damaging 0.99
IGL03085:Prss54 APN 8 95565630 missense probably benign 0.02
R0324:Prss54 UTSW 8 95565667 missense probably benign 0.00
R1487:Prss54 UTSW 8 95559648 missense probably benign 0.01
R2272:Prss54 UTSW 8 95571107 nonsense probably null
R4769:Prss54 UTSW 8 95559375 missense probably benign
R5275:Prss54 UTSW 8 95564478 missense probably damaging 1.00
R5295:Prss54 UTSW 8 95564478 missense probably damaging 1.00
R6117:Prss54 UTSW 8 95565458 splice site probably null
R6167:Prss54 UTSW 8 95559545 missense possibly damaging 0.71
R6791:Prss54 UTSW 8 95564655 intron probably null
R7179:Prss54 UTSW 8 95565571 missense probably benign 0.03
R7261:Prss54 UTSW 8 95559739 missense probably benign 0.02
R7864:Prss54 UTSW 8 95559669 missense probably benign 0.22
R7947:Prss54 UTSW 8 95559669 missense probably benign 0.22
Z1177:Prss54 UTSW 8 95564451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCTGAAGTTCTGCCCAGCATC -3'
(R):5'- GCCCCATTTCCAGAATCAATGCAAG -3'

Sequencing Primer
(F):5'- GGCCATTCAGCATAGGTATGTATAG -3'
(R):5'- GGCTTTCTAAAACAGACACTGG -3'
Posted On2013-09-03