Incidental Mutation 'R8794:Heatr5b'
ID 671155
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene Name HEAT repeat containing 5B
Synonyms 2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R8794 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78752906-78835381 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78815586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 655 (I655V)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
AlphaFold Q8C547
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: I655V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: I655V

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T A 17: 9,008,107 V498D unknown Het
Actn1 C T 12: 80,198,980 probably benign Het
Actrt2 T C 4: 154,666,719 E320G probably damaging Het
Adamts7 C T 9: 90,194,186 Q1265* probably null Het
Adra1a A G 14: 66,637,615 N13S probably benign Het
Alpk3 G T 7: 81,057,655 R9L unknown Het
Ankrd42 A G 7: 92,614,466 F225L probably benign Het
C3 T C 17: 57,221,011 E736G probably benign Het
Ccng1 A G 11: 40,753,999 S24P probably benign Het
Cdc42bpa A T 1: 180,067,251 N332I probably damaging Het
Cep131 G A 11: 120,081,248 P90S probably benign Het
Chd8 A G 14: 52,204,447 S2154P probably damaging Het
Cilp A G 9: 65,279,253 S877G probably benign Het
Clic6 T A 16: 92,528,099 S382T possibly damaging Het
Coq8a G T 1: 180,179,208 P85Q probably benign Het
Creb3l4 A G 3: 90,237,918 I309T probably benign Het
Cux2 T C 5: 121,869,243 E785G probably benign Het
Cyfip2 A G 11: 46,253,973 F685L possibly damaging Het
Epha6 T C 16: 60,205,672 D469G probably benign Het
Erc1 A T 6: 119,630,655 V962E probably damaging Het
Esrrb A T 12: 86,470,264 S57C probably damaging Het
Fam169a A G 13: 97,114,120 T320A possibly damaging Het
Farsb C T 1: 78,425,041 probably benign Het
Frem3 T C 8: 80,612,278 V400A probably damaging Het
Frem3 A T 8: 80,616,222 M1715L probably benign Het
Frmpd1 A G 4: 45,279,632 T786A probably benign Het
Gapvd1 A T 2: 34,704,318 S886T possibly damaging Het
Gba2 A G 4: 43,568,077 S737P probably damaging Het
Gm4869 A G 5: 140,476,030 E529G probably damaging Het
Gm525 A G 11: 89,088,653 N85S probably damaging Het
Gnpda1 T A 18: 38,332,038 D175V probably benign Het
Hmcn1 G A 1: 150,715,718 T1910I probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ier2 A T 8: 84,662,467 D95E probably damaging Het
Ifi208 A G 1: 173,695,804 R547G possibly damaging Het
Itih3 T A 14: 30,912,897 S639C possibly damaging Het
March7 G A 2: 60,243,671 probably null Het
Mep1b A C 18: 21,091,268 T373P probably damaging Het
Mlh3 G A 12: 85,235,723 P1379S probably damaging Het
Nav3 T A 10: 109,769,171 K1014* probably null Het
Nme1 A T 11: 93,960,832 F78I probably benign Het
Nos3 T A 5: 24,371,747 V458D probably damaging Het
Noxa1 A G 2: 25,094,840 F29L probably benign Het
Nrcam G A 12: 44,578,175 G1055D probably benign Het
Nutf2 A T 8: 105,875,539 probably benign Het
Olfr1218 T C 2: 89,055,133 M98V probably benign Het
Olfr1272 A T 2: 90,281,806 Y256* probably null Het
Olfr506 A T 7: 108,612,373 D22V probably benign Het
Olfr869 A T 9: 20,137,334 M73L possibly damaging Het
Oog3 A G 4: 144,157,986 I460T probably benign Het
Pde2a A T 7: 101,505,929 Y559F possibly damaging Het
Pde6d G A 1: 86,547,487 Q61* probably null Het
Pdpr A G 8: 111,125,608 T536A possibly damaging Het
Pias4 T A 10: 81,164,012 K69M probably damaging Het
Pigo A T 4: 43,023,787 D188E possibly damaging Het
Pik3r2 A G 8: 70,771,363 V270A probably benign Het
Plod2 T A 9: 92,600,748 W456R probably damaging Het
Pmpcb T C 5: 21,756,834 V450A probably benign Het
Poln G A 5: 34,129,527 T99I possibly damaging Het
Prg2 A G 2: 84,982,060 D38G possibly damaging Het
Psmd7 A C 8: 107,584,199 Y138D probably damaging Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Ranbp2 T A 10: 58,492,592 V2810E probably damaging Het
Rgma A T 7: 73,417,900 H411L probably damaging Het
Sapcd1 T C 17: 35,027,838 T25A probably damaging Het
Serpinb6e T C 13: 33,840,994 I105V possibly damaging Het
Serpinb9f A T 13: 33,329,413 T158S probably benign Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Skint6 A T 4: 113,192,672 S265R possibly damaging Het
Slc23a2 A T 2: 132,060,709 F524L probably benign Het
Slc2a13 C A 15: 91,350,099 G345C probably damaging Het
Sp110 A G 1: 85,583,510 probably null Het
Srcin1 A G 11: 97,548,977 V109A probably benign Het
Tfcp2l1 A G 1: 118,632,388 N70S probably damaging Het
Tmem30c T A 16: 57,270,190 H218L probably benign Het
Tmprss11d G A 5: 86,338,821 T70I probably damaging Het
Tnpo2 A T 8: 85,038,485 Q32L probably benign Het
Trav16n A C 14: 53,351,410 T48P probably damaging Het
Ufc1 A G 1: 171,289,522 Y110H probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Xirp2 A T 2: 67,511,213 E1266V probably damaging Het
Zfp423 A C 8: 87,781,229 L829R probably damaging Het
Zfp735 A G 11: 73,712,203 K658E possibly damaging Het
Zscan12 T A 13: 21,363,677 C10S possibly damaging Het
Zswim3 T A 2: 164,820,767 M389K probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 78821579 splice site probably null
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R7922:Heatr5b UTSW 17 78760559 missense probably benign 0.01
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 78791539 nonsense probably null
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
R8672:Heatr5b UTSW 17 78762203 missense probably damaging 1.00
R8781:Heatr5b UTSW 17 78795309 missense probably benign 0.19
R8808:Heatr5b UTSW 17 78765405 missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 78801759 missense probably benign 0.02
R8893:Heatr5b UTSW 17 78761995 splice site probably benign
R9010:Heatr5b UTSW 17 78773710 missense probably damaging 1.00
R9041:Heatr5b UTSW 17 78796432 missense probably benign 0.12
R9150:Heatr5b UTSW 17 78796019 missense probably benign
R9253:Heatr5b UTSW 17 78827994 missense probably benign 0.13
R9318:Heatr5b UTSW 17 78765402 missense probably benign 0.07
R9448:Heatr5b UTSW 17 78760586 missense probably benign 0.26
R9489:Heatr5b UTSW 17 78753250 nonsense probably null
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCTATCTCTCACAAGACAATTTCG -3'
(R):5'- TGAATTCTGAAGTGTTTCTGCTAGC -3'

Sequencing Primer
(F):5'- CAATTTCGAAGAGGAGTCCTGGTC -3'
(R):5'- AGTGTTTCTGCTAGCTTTGTTATTAC -3'
Posted On 2021-04-30