Incidental Mutation 'R8795:Ercc5'
ID 671159
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8795 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44163929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 242 (Y242F)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027214
AA Change: Y242F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: Y242F

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,672 M128L probably damaging Het
Abcc12 A G 8: 86,531,584 S768P possibly damaging Het
Adamts8 A T 9: 30,943,188 M118L probably benign Het
Adgrl4 A G 3: 151,510,779 N533S probably benign Het
Agk T G 6: 40,386,920 I278R possibly damaging Het
Atr T A 9: 95,867,531 W466R probably damaging Het
Cacna1h C T 17: 25,393,564 V387I probably damaging Het
Cand2 T G 6: 115,786,928 D270E probably benign Het
Ccdc107 C T 4: 43,495,514 T139M probably damaging Het
Cenpl A G 1: 161,083,014 E177G probably benign Het
Clint1 C A 11: 45,884,351 Q56K probably damaging Het
Col9a1 A G 1: 24,194,731 R249G unknown Het
Cpne5 C T 17: 29,204,688 probably benign Het
Ddx27 A G 2: 167,017,810 D54G probably benign Het
Dync2h1 C T 9: 7,137,087 E1468K probably benign Het
E130308A19Rik A T 4: 59,737,676 N429I possibly damaging Het
Endov G T 11: 119,499,554 G86C possibly damaging Het
Gabrr1 T A 4: 33,161,756 V360E probably damaging Het
Gcn1l1 T C 5: 115,614,395 I2153T probably benign Het
Gje1 T C 10: 14,718,126 N8S probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Greb1l A G 18: 10,553,739 H1580R probably damaging Het
Grin1 C G 2: 25,297,456 S614T probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ifitm2 A T 7: 140,955,748 H56Q probably damaging Het
Ifrd1 G A 12: 40,213,077 T218I possibly damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Impg2 A G 16: 56,260,248 E805G probably benign Het
Itgb6 T A 2: 60,653,285 N260Y probably damaging Het
Maneal G T 4: 124,856,690 Y424* probably null Het
Map4k2 T G 19: 6,351,610 C677W probably damaging Het
Med6 T C 12: 81,591,260 H59R probably benign Het
Mms22l T A 4: 24,536,245 D571E probably benign Het
Mroh8 A G 2: 157,225,573 F622S probably damaging Het
Mrpl44 A T 1: 79,776,257 Q42L probably damaging Het
Myh8 G T 11: 67,283,377 probably benign Het
Ndufb2 T C 6: 39,592,652 V13A probably benign Het
Nf1 T A 11: 79,425,616 L499Q probably damaging Het
Olfr1185-ps1 T G 2: 88,499,511 V142G probably damaging Het
Olfr1281 T A 2: 111,328,536 L39* probably null Het
Olfr1357 T C 10: 78,611,864 Y259C probably damaging Het
Olfr782 T C 10: 129,351,325 I254T probably damaging Het
Opa1 T C 16: 29,629,632 C874R probably damaging Het
Pld3 T A 7: 27,535,861 D314V possibly damaging Het
Pou6f1 A C 15: 100,587,805 C114W possibly damaging Het
Pqlc3 A G 12: 16,993,480 W150R probably damaging Het
Prl2c1 A C 13: 27,849,406 Q2P possibly damaging Het
Prl2c1 G T 13: 27,849,407 Q2H probably benign Het
Pzp C A 6: 128,494,738 K908N probably damaging Het
Rab6b G A 9: 103,162,626 G125D probably damaging Het
Rhbdd2 C T 5: 135,635,131 T69I probably benign Het
Samd9l A T 6: 3,374,221 Y1013* probably null Het
Slc13a4 T A 6: 35,283,295 T217S probably benign Het
Smarcad1 T C 6: 65,072,049 L253S probably benign Het
Snrpa C A 7: 27,191,609 V146L possibly damaging Het
Srrt A T 5: 137,299,976 D311E probably benign Het
Stk32b A T 5: 37,649,139 F20L probably damaging Het
Sult2a7 T C 7: 14,490,089 T136A probably benign Het
Sv2a G A 3: 96,187,080 V244I probably benign Het
Tesk1 T A 4: 43,446,070 probably null Het
Tmem260 A G 14: 48,451,913 H63R probably damaging Het
Ugt1a6b A G 1: 88,107,072 E44G probably benign Het
Unc79 A T 12: 103,108,254 I1363F probably damaging Het
Usp15 T A 10: 123,153,048 N255Y probably benign Het
Usp35 A G 7: 97,311,960 V753A possibly damaging Het
Usp35 T C 7: 97,312,063 N719D probably benign Het
Vmn2r104 T A 17: 20,042,726 I158L probably benign Het
Vmn2r69 A T 7: 85,415,675 M1K probably null Het
Zan C T 5: 137,398,260 E4345K unknown Het
Zc3h7a A T 16: 11,147,283 M662K possibly damaging Het
Zfp512 G A 5: 31,476,790 V438M probably damaging Het
Zfy1 T C Y: 738,945 D87G unknown Het
Zmym4 A T 4: 126,906,026 V653E probably benign Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44158857 missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAAGTTGACAGTGGAACCC -3'
(R):5'- AGAGCACTGCATACCTATCATG -3'

Sequencing Primer
(F):5'- CAGTGGAACCCCCTTAATTTTCAAG -3'
(R):5'- TGTCAAATCAATGATGGCGCCTG -3'
Posted On 2021-04-30