Incidental Mutation 'R8795:Dync2h1'
ID 671202
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms 4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8795 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 6928503-7184446 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7137087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1468 (E1468K)
Ref Sequence ENSEMBL: ENSMUSP00000046733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: E1468K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: E1468K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: E1468K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: E1468K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: E1468K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: E1468K

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,672 M128L probably damaging Het
Abcc12 A G 8: 86,531,584 S768P possibly damaging Het
Adamts8 A T 9: 30,943,188 M118L probably benign Het
Adgrl4 A G 3: 151,510,779 N533S probably benign Het
Agk T G 6: 40,386,920 I278R possibly damaging Het
Atr T A 9: 95,867,531 W466R probably damaging Het
Cacna1h C T 17: 25,393,564 V387I probably damaging Het
Cand2 T G 6: 115,786,928 D270E probably benign Het
Ccdc107 C T 4: 43,495,514 T139M probably damaging Het
Cenpl A G 1: 161,083,014 E177G probably benign Het
Clint1 C A 11: 45,884,351 Q56K probably damaging Het
Col9a1 A G 1: 24,194,731 R249G unknown Het
Cpne5 C T 17: 29,204,688 probably benign Het
Ddx27 A G 2: 167,017,810 D54G probably benign Het
E130308A19Rik A T 4: 59,737,676 N429I possibly damaging Het
Endov G T 11: 119,499,554 G86C possibly damaging Het
Ercc5 A T 1: 44,163,929 Y242F possibly damaging Het
Gabrr1 T A 4: 33,161,756 V360E probably damaging Het
Gcn1l1 T C 5: 115,614,395 I2153T probably benign Het
Gje1 T C 10: 14,718,126 N8S probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Greb1l A G 18: 10,553,739 H1580R probably damaging Het
Grin1 C G 2: 25,297,456 S614T probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ifitm2 A T 7: 140,955,748 H56Q probably damaging Het
Ifrd1 G A 12: 40,213,077 T218I possibly damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Impg2 A G 16: 56,260,248 E805G probably benign Het
Itgb6 T A 2: 60,653,285 N260Y probably damaging Het
Maneal G T 4: 124,856,690 Y424* probably null Het
Map4k2 T G 19: 6,351,610 C677W probably damaging Het
Med6 T C 12: 81,591,260 H59R probably benign Het
Mms22l T A 4: 24,536,245 D571E probably benign Het
Mroh8 A G 2: 157,225,573 F622S probably damaging Het
Mrpl44 A T 1: 79,776,257 Q42L probably damaging Het
Myh8 G T 11: 67,283,377 probably benign Het
Ndufb2 T C 6: 39,592,652 V13A probably benign Het
Nf1 T A 11: 79,425,616 L499Q probably damaging Het
Olfr1185-ps1 T G 2: 88,499,511 V142G probably damaging Het
Olfr1281 T A 2: 111,328,536 L39* probably null Het
Olfr1357 T C 10: 78,611,864 Y259C probably damaging Het
Olfr782 T C 10: 129,351,325 I254T probably damaging Het
Opa1 T C 16: 29,629,632 C874R probably damaging Het
Pld3 T A 7: 27,535,861 D314V possibly damaging Het
Pou6f1 A C 15: 100,587,805 C114W possibly damaging Het
Pqlc3 A G 12: 16,993,480 W150R probably damaging Het
Prl2c1 A C 13: 27,849,406 Q2P possibly damaging Het
Prl2c1 G T 13: 27,849,407 Q2H probably benign Het
Pzp C A 6: 128,494,738 K908N probably damaging Het
Rab6b G A 9: 103,162,626 G125D probably damaging Het
Rhbdd2 C T 5: 135,635,131 T69I probably benign Het
Samd9l A T 6: 3,374,221 Y1013* probably null Het
Slc13a4 T A 6: 35,283,295 T217S probably benign Het
Smarcad1 T C 6: 65,072,049 L253S probably benign Het
Snrpa C A 7: 27,191,609 V146L possibly damaging Het
Srrt A T 5: 137,299,976 D311E probably benign Het
Stk32b A T 5: 37,649,139 F20L probably damaging Het
Sult2a7 T C 7: 14,490,089 T136A probably benign Het
Sv2a G A 3: 96,187,080 V244I probably benign Het
Tesk1 T A 4: 43,446,070 probably null Het
Tmem260 A G 14: 48,451,913 H63R probably damaging Het
Ugt1a6b A G 1: 88,107,072 E44G probably benign Het
Unc79 A T 12: 103,108,254 I1363F probably damaging Het
Usp15 T A 10: 123,153,048 N255Y probably benign Het
Usp35 A G 7: 97,311,960 V753A possibly damaging Het
Usp35 T C 7: 97,312,063 N719D probably benign Het
Vmn2r104 T A 17: 20,042,726 I158L probably benign Het
Vmn2r69 A T 7: 85,415,675 M1K probably null Het
Zan C T 5: 137,398,260 E4345K unknown Het
Zc3h7a A T 16: 11,147,283 M662K possibly damaging Het
Zfp512 G A 5: 31,476,790 V438M probably damaging Het
Zfy1 T C Y: 738,945 D87G unknown Het
Zmym4 A T 4: 126,906,026 V653E probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
deinonychus UTSW 9 7159478 splice site probably null
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 splice site probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7011247 missense probably benign
R7351:Dync2h1 UTSW 9 7167145 missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7159479 critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7157932 missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7041720 missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7132041 missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7124855 missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7135015 splice site probably null
R7501:Dync2h1 UTSW 9 7175336 missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7002623 missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7101111 missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7141254 missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7117570 missense probably benign
R7654:Dync2h1 UTSW 9 7122664 missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7076232 missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7015490 missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7129719 missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7114914 missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7118953 missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7005566 missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7129802 missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7148688 missense probably benign 0.03
R8157:Dync2h1 UTSW 9 7001473 missense possibly damaging 0.47
R8166:Dync2h1 UTSW 9 7129089 nonsense probably null
R8236:Dync2h1 UTSW 9 7080363 intron probably benign
R8326:Dync2h1 UTSW 9 7147771 missense probably benign
R8335:Dync2h1 UTSW 9 7084941 missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7116578 missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7111514 missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7102477 missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7051452 missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7113198 missense probably benign 0.32
R8690:Dync2h1 UTSW 9 7075824 missense probably damaging 1.00
R8713:Dync2h1 UTSW 9 7141008 nonsense probably null
R8719:Dync2h1 UTSW 9 7041641 missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7168326 missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7011220 nonsense probably null
R8749:Dync2h1 UTSW 9 7035063 missense probably benign 0.32
R8853:Dync2h1 UTSW 9 7117645 missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7168515 missense probably benign
R8969:Dync2h1 UTSW 9 7130723 missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7037727 missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7129003 missense probably benign
R9025:Dync2h1 UTSW 9 7139462 nonsense probably null
R9036:Dync2h1 UTSW 9 7051495 missense probably damaging 1.00
R9165:Dync2h1 UTSW 9 7114883 missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7031771 missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6941668 missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7050413 missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7112149 missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7176911 missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7125730 critical splice donor site probably null
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7142361 missense probably damaging 0.99
Z1176:Dync2h1 UTSW 9 7168730 frame shift probably null
Z1177:Dync2h1 UTSW 9 7102427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGAGCTGACACAATATGTAGCT -3'
(R):5'- AATCAGGGCATAGCTAGATGTT -3'

Sequencing Primer
(F):5'- TTTTCAGTCCACAACTAAAGTTCC -3'
(R):5'- GAGTACCCAGTGAAAGTATTTTTCC -3'
Posted On 2021-04-30