Incidental Mutation 'R8795:Nf1'
ID 671212
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Name neurofibromin 1
Synonyms Nf-1, neurofibromin
MMRRC Submission
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8795 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 79339693-79581612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79425616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 499 (L499Q)
Ref Sequence ENSEMBL: ENSMUSP00000071289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071325
AA Change: L499Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: L499Q

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108251
AA Change: L499Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: L499Q

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219057
AA Change: L509Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8965 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,672 M128L probably damaging Het
Abcc12 A G 8: 86,531,584 S768P possibly damaging Het
Adamts8 A T 9: 30,943,188 M118L probably benign Het
Adgrl4 A G 3: 151,510,779 N533S probably benign Het
Agk T G 6: 40,386,920 I278R possibly damaging Het
Atr T A 9: 95,867,531 W466R probably damaging Het
Cacna1h C T 17: 25,393,564 V387I probably damaging Het
Cand2 T G 6: 115,786,928 D270E probably benign Het
Ccdc107 C T 4: 43,495,514 T139M probably damaging Het
Cenpl A G 1: 161,083,014 E177G probably benign Het
Clint1 C A 11: 45,884,351 Q56K probably damaging Het
Col9a1 A G 1: 24,194,731 R249G unknown Het
Cpne5 C T 17: 29,204,688 probably benign Het
Ddx27 A G 2: 167,017,810 D54G probably benign Het
Dync2h1 C T 9: 7,137,087 E1468K probably benign Het
E130308A19Rik A T 4: 59,737,676 N429I possibly damaging Het
Endov G T 11: 119,499,554 G86C possibly damaging Het
Ercc5 A T 1: 44,163,929 Y242F possibly damaging Het
Gabrr1 T A 4: 33,161,756 V360E probably damaging Het
Gcn1l1 T C 5: 115,614,395 I2153T probably benign Het
Gje1 T C 10: 14,718,126 N8S probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Greb1l A G 18: 10,553,739 H1580R probably damaging Het
Grin1 C G 2: 25,297,456 S614T probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ifitm2 A T 7: 140,955,748 H56Q probably damaging Het
Ifrd1 G A 12: 40,213,077 T218I possibly damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Impg2 A G 16: 56,260,248 E805G probably benign Het
Itgb6 T A 2: 60,653,285 N260Y probably damaging Het
Maneal G T 4: 124,856,690 Y424* probably null Het
Map4k2 T G 19: 6,351,610 C677W probably damaging Het
Med6 T C 12: 81,591,260 H59R probably benign Het
Mms22l T A 4: 24,536,245 D571E probably benign Het
Mroh8 A G 2: 157,225,573 F622S probably damaging Het
Mrpl44 A T 1: 79,776,257 Q42L probably damaging Het
Myh8 G T 11: 67,283,377 probably benign Het
Ndufb2 T C 6: 39,592,652 V13A probably benign Het
Olfr1185-ps1 T G 2: 88,499,511 V142G probably damaging Het
Olfr1281 T A 2: 111,328,536 L39* probably null Het
Olfr1357 T C 10: 78,611,864 Y259C probably damaging Het
Olfr782 T C 10: 129,351,325 I254T probably damaging Het
Opa1 T C 16: 29,629,632 C874R probably damaging Het
Pld3 T A 7: 27,535,861 D314V possibly damaging Het
Pou6f1 A C 15: 100,587,805 C114W possibly damaging Het
Pqlc3 A G 12: 16,993,480 W150R probably damaging Het
Prl2c1 A C 13: 27,849,406 Q2P possibly damaging Het
Prl2c1 G T 13: 27,849,407 Q2H probably benign Het
Pzp C A 6: 128,494,738 K908N probably damaging Het
Rab6b G A 9: 103,162,626 G125D probably damaging Het
Rhbdd2 C T 5: 135,635,131 T69I probably benign Het
Samd9l A T 6: 3,374,221 Y1013* probably null Het
Slc13a4 T A 6: 35,283,295 T217S probably benign Het
Smarcad1 T C 6: 65,072,049 L253S probably benign Het
Snrpa C A 7: 27,191,609 V146L possibly damaging Het
Srrt A T 5: 137,299,976 D311E probably benign Het
Stk32b A T 5: 37,649,139 F20L probably damaging Het
Sult2a7 T C 7: 14,490,089 T136A probably benign Het
Sv2a G A 3: 96,187,080 V244I probably benign Het
Tesk1 T A 4: 43,446,070 probably null Het
Tmem260 A G 14: 48,451,913 H63R probably damaging Het
Ugt1a6b A G 1: 88,107,072 E44G probably benign Het
Unc79 A T 12: 103,108,254 I1363F probably damaging Het
Usp15 T A 10: 123,153,048 N255Y probably benign Het
Usp35 A G 7: 97,311,960 V753A possibly damaging Het
Usp35 T C 7: 97,312,063 N719D probably benign Het
Vmn2r104 T A 17: 20,042,726 I158L probably benign Het
Vmn2r69 A T 7: 85,415,675 M1K probably null Het
Zan C T 5: 137,398,260 E4345K unknown Het
Zc3h7a A T 16: 11,147,283 M662K possibly damaging Het
Zfp512 G A 5: 31,476,790 V438M probably damaging Het
Zfy1 T C Y: 738,945 D87G unknown Het
Zmym4 A T 4: 126,906,026 V653E probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
hancock UTSW 11 79536850 missense probably benign
independence UTSW 11 79454310 intron probably benign
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
responsibility UTSW 11 79565975 missense probably damaging 0.99
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 splice site probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 splice site probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7545:Nf1 UTSW 11 79409524 missense probably benign
R7567:Nf1 UTSW 11 79547226 missense probably damaging 0.99
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
R7869:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7905:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
R8232:Nf1 UTSW 11 79578331 missense probably damaging 0.96
R8244:Nf1 UTSW 11 79440924 missense probably benign
R8397:Nf1 UTSW 11 79547692 missense probably damaging 1.00
R8436:Nf1 UTSW 11 79458883 missense probably damaging 0.99
R8492:Nf1 UTSW 11 79408422 missense probably benign 0.06
R8719:Nf1 UTSW 11 79390293 missense possibly damaging 0.86
R8735:Nf1 UTSW 11 79454310 intron probably benign
R8797:Nf1 UTSW 11 79475885 critical splice donor site probably benign
R8809:Nf1 UTSW 11 79547138 missense probably damaging 0.99
R8812:Nf1 UTSW 11 79546354 missense probably damaging 0.96
R8815:Nf1 UTSW 11 79441665 missense probably damaging 1.00
R8828:Nf1 UTSW 11 79395853 critical splice acceptor site probably null
R8894:Nf1 UTSW 11 79445793 missense probably damaging 1.00
R9051:Nf1 UTSW 11 79473342 missense probably damaging 1.00
R9103:Nf1 UTSW 11 79559506 missense probably damaging 0.99
R9142:Nf1 UTSW 11 79471489 missense probably damaging 1.00
R9142:Nf1 UTSW 11 79475862 missense probably damaging 1.00
R9170:Nf1 UTSW 11 79545465 missense probably damaging 1.00
R9201:Nf1 UTSW 11 79570330 missense probably benign 0.08
R9267:Nf1 UTSW 11 79440890 missense possibly damaging 0.72
R9309:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R9340:Nf1 UTSW 11 79556803 missense possibly damaging 0.90
R9398:Nf1 UTSW 11 79547192 missense probably damaging 0.99
R9471:Nf1 UTSW 11 79545369 missense probably damaging 0.99
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79564925 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTATCATACATTTGGTGGTATG -3'
(R):5'- CTATGGACAGTTCAATGCGGAGG -3'

Sequencing Primer
(F):5'- GTTTCTAAGGTGATGCCATG -3'
(R):5'- CAGTTCAATGCGGAGGGAACG -3'
Posted On 2021-04-30