Mutagenetix > Incidental Mutations

Incidental Mutation 'R8795:Nf1'

671212

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Nf-1, neurofibromin

MMRRC Submission

Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8795 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79339693-79581612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79425616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 499 (L499Q)

Ref Sequence

ENSEMBL: ENSMUSP00000071289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071325
AA Change: L499Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: L499Q

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108251
AA Change: L499Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: L499Q

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000219057
AA Change: L509Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8965

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,672	M128L	probably damaging	Het
Abcc12	A	G	8: 86,531,584	S768P	possibly damaging	Het
Adamts8	A	T	9: 30,943,188	M118L	probably benign	Het
Adgrl4	A	G	3: 151,510,779	N533S	probably benign	Het
Agk	T	G	6: 40,386,920	I278R	possibly damaging	Het
Atr	T	A	9: 95,867,531	W466R	probably damaging	Het
Cacna1h	C	T	17: 25,393,564	V387I	probably damaging	Het
Cand2	T	G	6: 115,786,928	D270E	probably benign	Het
Ccdc107	C	T	4: 43,495,514	T139M	probably damaging	Het
Cenpl	A	G	1: 161,083,014	E177G	probably benign	Het
Clint1	C	A	11: 45,884,351	Q56K	probably damaging	Het
Col9a1	A	G	1: 24,194,731	R249G	unknown	Het
Cpne5	C	T	17: 29,204,688		probably benign	Het
Ddx27	A	G	2: 167,017,810	D54G	probably benign	Het
Dync2h1	C	T	9: 7,137,087	E1468K	probably benign	Het
E130308A19Rik	A	T	4: 59,737,676	N429I	possibly damaging	Het
Endov	G	T	11: 119,499,554	G86C	possibly damaging	Het
Ercc5	A	T	1: 44,163,929	Y242F	possibly damaging	Het
Gabrr1	T	A	4: 33,161,756	V360E	probably damaging	Het
Gcn1l1	T	C	5: 115,614,395	I2153T	probably benign	Het
Gje1	T	C	10: 14,718,126	N8S	probably benign	Het
Gm12394	A	G	4: 42,792,992	V380A	probably benign	Het
Greb1l	A	G	18: 10,553,739	H1580R	probably damaging	Het
Grin1	C	G	2: 25,297,456	S614T	probably damaging	Het
Hmcn2	A	G	2: 31,425,381	N3714S	probably benign	Het
Idh1	CA	CAA	1: 65,165,188		probably null	Het
Ifitm2	A	T	7: 140,955,748	H56Q	probably damaging	Het
Ifrd1	G	A	12: 40,213,077	T218I	possibly damaging	Het
Igkv1-99	G	T	6: 68,542,386	G109V		Het
Impg2	A	G	16: 56,260,248	E805G	probably benign	Het
Itgb6	T	A	2: 60,653,285	N260Y	probably damaging	Het
Maneal	G	T	4: 124,856,690	Y424*	probably null	Het
Map4k2	T	G	19: 6,351,610	C677W	probably damaging	Het
Med6	T	C	12: 81,591,260	H59R	probably benign	Het
Mms22l	T	A	4: 24,536,245	D571E	probably benign	Het
Mroh8	A	G	2: 157,225,573	F622S	probably damaging	Het
Mrpl44	A	T	1: 79,776,257	Q42L	probably damaging	Het
Myh8	G	T	11: 67,283,377		probably benign	Het
Ndufb2	T	C	6: 39,592,652	V13A	probably benign	Het
Olfr1185-ps1	T	G	2: 88,499,511	V142G	probably damaging	Het
Olfr1281	T	A	2: 111,328,536	L39*	probably null	Het
Olfr1357	T	C	10: 78,611,864	Y259C	probably damaging	Het
Olfr782	T	C	10: 129,351,325	I254T	probably damaging	Het
Opa1	T	C	16: 29,629,632	C874R	probably damaging	Het
Pld3	T	A	7: 27,535,861	D314V	possibly damaging	Het
Pou6f1	A	C	15: 100,587,805	C114W	possibly damaging	Het
Pqlc3	A	G	12: 16,993,480	W150R	probably damaging	Het
Prl2c1	A	C	13: 27,849,406	Q2P	possibly damaging	Het
Prl2c1	G	T	13: 27,849,407	Q2H	probably benign	Het
Pzp	C	A	6: 128,494,738	K908N	probably damaging	Het
Rab6b	G	A	9: 103,162,626	G125D	probably damaging	Het
Rhbdd2	C	T	5: 135,635,131	T69I	probably benign	Het
Samd9l	A	T	6: 3,374,221	Y1013*	probably null	Het
Slc13a4	T	A	6: 35,283,295	T217S	probably benign	Het
Smarcad1	T	C	6: 65,072,049	L253S	probably benign	Het
Snrpa	C	A	7: 27,191,609	V146L	possibly damaging	Het
Srrt	A	T	5: 137,299,976	D311E	probably benign	Het
Stk32b	A	T	5: 37,649,139	F20L	probably damaging	Het
Sult2a7	T	C	7: 14,490,089	T136A	probably benign	Het
Sv2a	G	A	3: 96,187,080	V244I	probably benign	Het
Tesk1	T	A	4: 43,446,070		probably null	Het
Tmem260	A	G	14: 48,451,913	H63R	probably damaging	Het
Ugt1a6b	A	G	1: 88,107,072	E44G	probably benign	Het
Unc79	A	T	12: 103,108,254	I1363F	probably damaging	Het
Usp15	T	A	10: 123,153,048	N255Y	probably benign	Het
Usp35	A	G	7: 97,311,960	V753A	possibly damaging	Het
Usp35	T	C	7: 97,312,063	N719D	probably benign	Het
Vmn2r104	T	A	17: 20,042,726	I158L	probably benign	Het
Vmn2r69	A	T	7: 85,415,675	M1K	probably null	Het
Zan	C	T	5: 137,398,260	E4345K	unknown	Het
Zc3h7a	A	T	16: 11,147,283	M662K	possibly damaging	Het
Zfp512	G	A	5: 31,476,790	V438M	probably damaging	Het
Zfy1	T	C	Y: 738,945	D87G	unknown	Het
Zmym4	A	T	4: 126,906,026	V653E	probably benign	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79395905	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79428700	splice site	probably benign
IGL00823:Nf1	APN	11	79565517	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79469803	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79445121	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79546986	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79441709	splice site	probably benign
IGL01637:Nf1	APN	11	79547120	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79559449	missense	probably benign
IGL01764:Nf1	APN	11	79384187	missense	probably benign
IGL01772:Nf1	APN	11	79390249	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79425535	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79412727	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79444121	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79444648	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79564926	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79565935	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79411676	splice site	probably benign
IGL02475:Nf1	APN	11	79535667	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79547143	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79428627	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79444598	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79444599	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79434933	splice site	probably benign
IGL03006:Nf1	APN	11	79545431	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79564895	missense	probably benign	0.17
Diesel	UTSW	11	79556723	missense	probably damaging	0.96
Franklin	UTSW	11	79473320	splice site	probably null
Gasoline	UTSW	11	79556789	missense	probably benign	0.17
hancock	UTSW	11	79536850	missense	probably benign
independence	UTSW	11	79454310	intron	probably benign
jackson	UTSW	11	79447572	missense	probably damaging	1.00
Jefferson	UTSW	11	79446864	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79454189	missense	probably damaging	1.00
responsibility	UTSW	11	79565975	missense	probably damaging	0.99
C9142:Nf1	UTSW	11	79556731	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79547776	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79453979	splice site	probably benign
R0115:Nf1	UTSW	11	79468876	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79547127	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R0196:Nf1	UTSW	11	79578272	missense	probably damaging	1.00
R0217:Nf1	UTSW	11	79428574	splice site	probably benign
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79408699	splice site	probably null
R0362:Nf1	UTSW	11	79536878	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79441957	nonsense	probably null
R0464:Nf1	UTSW	11	79556789	missense	probably benign	0.17
R0511:Nf1	UTSW	11	79438769	missense	probably benign	0.01
R0549:Nf1	UTSW	11	79468771	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79568701	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79535703	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79453866	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79438711	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1350:Nf1	UTSW	11	79412687	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79547885	splice site	probably null
R1395:Nf1	UTSW	11	79535983	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79395859	nonsense	probably null
R1508:Nf1	UTSW	11	79440909	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79390369	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79440923	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79550998	nonsense	probably null
R1704:Nf1	UTSW	11	79463301	splice site	probably null
R1707:Nf1	UTSW	11	79535604	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79443931	missense	probably benign
R1761:Nf1	UTSW	11	79384265	missense	probably damaging	1.00
R1800:Nf1	UTSW	11	79553968	missense	possibly damaging	0.94
R1873:Nf1	UTSW	11	79547161	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79411564	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79412745	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79553961	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79556723	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79469826	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79447570	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79444064	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79443884	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79412758	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79546986	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79564899	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79548747	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79559521	missense	probably null	0.98
R3804:Nf1	UTSW	11	79559521	missense	probably null	0.98
R4212:Nf1	UTSW	11	79469798	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79384244	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79445759	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79468757	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79536037	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79447572	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79546297	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79409409	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79565553	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79444643	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79444150	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79446864	missense	probably damaging	1.00
R5207:Nf1	UTSW	11	79454189	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79564899	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79473456	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79443959	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79445789	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79569222	intron	probably benign
R5978:Nf1	UTSW	11	79540419	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79473320	splice site	probably null
R6195:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79411607	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79549491	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79565755	splice site	probably null
R6756:Nf1	UTSW	11	79444587	splice site	probably null
R6878:Nf1	UTSW	11	79434882	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79549468	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79447023	splice site	probably null
R7066:Nf1	UTSW	11	79556720	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79469819	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79564943	missense	probably benign
R7348:Nf1	UTSW	11	79536850	missense	probably benign
R7380:Nf1	UTSW	11	79546276	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79448143	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79473414	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79409524	missense	probably benign
R7567:Nf1	UTSW	11	79547226	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79408769	missense	probably null	0.99
R7616:Nf1	UTSW	11	79384266	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79425606	missense	probably benign
R7737:Nf1	UTSW	11	79545488	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79418588	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79547112	missense	possibly damaging	0.80
R8232:Nf1	UTSW	11	79578331	missense	probably damaging	0.96
R8244:Nf1	UTSW	11	79440924	missense	probably benign
R8397:Nf1	UTSW	11	79547692	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79458883	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79408422	missense	probably benign	0.06
R8719:Nf1	UTSW	11	79390293	missense	possibly damaging	0.86
R8735:Nf1	UTSW	11	79454310	intron	probably benign
R8797:Nf1	UTSW	11	79475885	critical splice donor site	probably benign
R8809:Nf1	UTSW	11	79547138	missense	probably damaging	0.99
R8812:Nf1	UTSW	11	79546354	missense	probably damaging	0.96
R8815:Nf1	UTSW	11	79441665	missense	probably damaging	1.00
R8828:Nf1	UTSW	11	79395853	critical splice acceptor site	probably null
R8894:Nf1	UTSW	11	79445793	missense	probably damaging	1.00
R9051:Nf1	UTSW	11	79473342	missense	probably damaging	1.00
R9103:Nf1	UTSW	11	79559506	missense	probably damaging	0.99
R9142:Nf1	UTSW	11	79471489	missense	probably damaging	1.00
R9142:Nf1	UTSW	11	79475862	missense	probably damaging	1.00
R9170:Nf1	UTSW	11	79545465	missense	probably damaging	1.00
R9201:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R9267:Nf1	UTSW	11	79440890	missense	possibly damaging	0.72
R9309:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R9340:Nf1	UTSW	11	79556803	missense	possibly damaging	0.90
R9398:Nf1	UTSW	11	79547192	missense	probably damaging	0.99
R9471:Nf1	UTSW	11	79545369	missense	probably damaging	0.99
X0052:Nf1	UTSW	11	79559416	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79564925	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAGTATCATACATTTGGTGGTATG -3'
(R):5'- CTATGGACAGTTCAATGCGGAGG -3'

Sequencing Primer
(F):5'- GTTTCTAAGGTGATGCCATG -3'
(R):5'- CAGTTCAATGCGGAGGGAACG -3'

Posted On

2021-04-30