Incidental Mutation 'R8795:Tmem260'
ID 671220
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8795 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48451913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 63 (H63R)
Ref Sequence ENSEMBL: ENSMUSP00000107364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226400] [ENSMUST00000226422] [ENSMUST00000227440]
AlphaFold Q8BMD6
Predicted Effect probably damaging
Transcript: ENSMUST00000111735
AA Change: H63R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: H63R

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124720
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153765
AA Change: H63R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339
AA Change: H63R

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226400
Predicted Effect probably damaging
Transcript: ENSMUST00000226422
AA Change: H63R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227440
AA Change: H63R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9365 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,672 M128L probably damaging Het
Abcc12 A G 8: 86,531,584 S768P possibly damaging Het
Adamts8 A T 9: 30,943,188 M118L probably benign Het
Adgrl4 A G 3: 151,510,779 N533S probably benign Het
Agk T G 6: 40,386,920 I278R possibly damaging Het
Atr T A 9: 95,867,531 W466R probably damaging Het
Cacna1h C T 17: 25,393,564 V387I probably damaging Het
Cand2 T G 6: 115,786,928 D270E probably benign Het
Ccdc107 C T 4: 43,495,514 T139M probably damaging Het
Cenpl A G 1: 161,083,014 E177G probably benign Het
Clint1 C A 11: 45,884,351 Q56K probably damaging Het
Col9a1 A G 1: 24,194,731 R249G unknown Het
Cpne5 C T 17: 29,204,688 probably benign Het
Ddx27 A G 2: 167,017,810 D54G probably benign Het
Dync2h1 C T 9: 7,137,087 E1468K probably benign Het
E130308A19Rik A T 4: 59,737,676 N429I possibly damaging Het
Endov G T 11: 119,499,554 G86C possibly damaging Het
Ercc5 A T 1: 44,163,929 Y242F possibly damaging Het
Gabrr1 T A 4: 33,161,756 V360E probably damaging Het
Gcn1l1 T C 5: 115,614,395 I2153T probably benign Het
Gje1 T C 10: 14,718,126 N8S probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Greb1l A G 18: 10,553,739 H1580R probably damaging Het
Grin1 C G 2: 25,297,456 S614T probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ifitm2 A T 7: 140,955,748 H56Q probably damaging Het
Ifrd1 G A 12: 40,213,077 T218I possibly damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Impg2 A G 16: 56,260,248 E805G probably benign Het
Itgb6 T A 2: 60,653,285 N260Y probably damaging Het
Maneal G T 4: 124,856,690 Y424* probably null Het
Map4k2 T G 19: 6,351,610 C677W probably damaging Het
Med6 T C 12: 81,591,260 H59R probably benign Het
Mms22l T A 4: 24,536,245 D571E probably benign Het
Mroh8 A G 2: 157,225,573 F622S probably damaging Het
Mrpl44 A T 1: 79,776,257 Q42L probably damaging Het
Myh8 G T 11: 67,283,377 probably benign Het
Ndufb2 T C 6: 39,592,652 V13A probably benign Het
Nf1 T A 11: 79,425,616 L499Q probably damaging Het
Olfr1185-ps1 T G 2: 88,499,511 V142G probably damaging Het
Olfr1281 T A 2: 111,328,536 L39* probably null Het
Olfr1357 T C 10: 78,611,864 Y259C probably damaging Het
Olfr782 T C 10: 129,351,325 I254T probably damaging Het
Opa1 T C 16: 29,629,632 C874R probably damaging Het
Pld3 T A 7: 27,535,861 D314V possibly damaging Het
Pou6f1 A C 15: 100,587,805 C114W possibly damaging Het
Pqlc3 A G 12: 16,993,480 W150R probably damaging Het
Prl2c1 A C 13: 27,849,406 Q2P possibly damaging Het
Prl2c1 G T 13: 27,849,407 Q2H probably benign Het
Pzp C A 6: 128,494,738 K908N probably damaging Het
Rab6b G A 9: 103,162,626 G125D probably damaging Het
Rhbdd2 C T 5: 135,635,131 T69I probably benign Het
Samd9l A T 6: 3,374,221 Y1013* probably null Het
Slc13a4 T A 6: 35,283,295 T217S probably benign Het
Smarcad1 T C 6: 65,072,049 L253S probably benign Het
Snrpa C A 7: 27,191,609 V146L possibly damaging Het
Srrt A T 5: 137,299,976 D311E probably benign Het
Stk32b A T 5: 37,649,139 F20L probably damaging Het
Sult2a7 T C 7: 14,490,089 T136A probably benign Het
Sv2a G A 3: 96,187,080 V244I probably benign Het
Tesk1 T A 4: 43,446,070 probably null Het
Ugt1a6b A G 1: 88,107,072 E44G probably benign Het
Unc79 A T 12: 103,108,254 I1363F probably damaging Het
Usp15 T A 10: 123,153,048 N255Y probably benign Het
Usp35 A G 7: 97,311,960 V753A possibly damaging Het
Usp35 T C 7: 97,312,063 N719D probably benign Het
Vmn2r104 T A 17: 20,042,726 I158L probably benign Het
Vmn2r69 A T 7: 85,415,675 M1K probably null Het
Zan C T 5: 137,398,260 E4345K unknown Het
Zc3h7a A T 16: 11,147,283 M662K possibly damaging Het
Zfp512 G A 5: 31,476,790 V438M probably damaging Het
Zfy1 T C Y: 738,945 D87G unknown Het
Zmym4 A T 4: 126,906,026 V653E probably benign Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 splice site probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9056:Tmem260 UTSW 14 48480317 missense probably benign
R9096:Tmem260 UTSW 14 48520346 missense unknown
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGATATACAGGCCAGGTCCC -3'
(R):5'- AACCCGCAACGCTTAATTTC -3'

Sequencing Primer
(F):5'- CATTTAGGCATCCCCACA -3'
(R):5'- CGCAACGCTTAATTTCTCAAAG -3'
Posted On 2021-04-30