Mutagenetix > Incidental Mutation

Incidental Mutation 'R8795:Greb1l'

671230

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

068636-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8795 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10553739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1580 (H1580R)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: H1580R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H1580R

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (72/74)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,672	M128L	probably damaging	Het
Abcc12	A	G	8: 86,531,584	S768P	possibly damaging	Het
Adamts8	A	T	9: 30,943,188	M118L	probably benign	Het
Adgrl4	A	G	3: 151,510,779	N533S	probably benign	Het
Agk	T	G	6: 40,386,920	I278R	possibly damaging	Het
Atr	T	A	9: 95,867,531	W466R	probably damaging	Het
Cacna1h	C	T	17: 25,393,564	V387I	probably damaging	Het
Cand2	T	G	6: 115,786,928	D270E	probably benign	Het
Ccdc107	C	T	4: 43,495,514	T139M	probably damaging	Het
Cenpl	A	G	1: 161,083,014	E177G	probably benign	Het
Clint1	C	A	11: 45,884,351	Q56K	probably damaging	Het
Col9a1	A	G	1: 24,194,731	R249G	unknown	Het
Cpne5	C	T	17: 29,204,688		probably benign	Het
Ddx27	A	G	2: 167,017,810	D54G	probably benign	Het
Dync2h1	C	T	9: 7,137,087	E1468K	probably benign	Het
E130308A19Rik	A	T	4: 59,737,676	N429I	possibly damaging	Het
Endov	G	T	11: 119,499,554	G86C	possibly damaging	Het
Ercc5	A	T	1: 44,163,929	Y242F	possibly damaging	Het
Gabrr1	T	A	4: 33,161,756	V360E	probably damaging	Het
Gcn1l1	T	C	5: 115,614,395	I2153T	probably benign	Het
Gje1	T	C	10: 14,718,126	N8S	probably benign	Het
Gm12394	A	G	4: 42,792,992	V380A	probably benign	Het
Grin1	C	G	2: 25,297,456	S614T	probably damaging	Het
Hmcn2	A	G	2: 31,425,381	N3714S	probably benign	Het
Idh1	CA	CAA	1: 65,165,188		probably null	Het
Ifitm2	A	T	7: 140,955,748	H56Q	probably damaging	Het
Ifrd1	G	A	12: 40,213,077	T218I	possibly damaging	Het
Igkv1-99	G	T	6: 68,542,386	G109V		Het
Impg2	A	G	16: 56,260,248	E805G	probably benign	Het
Itgb6	T	A	2: 60,653,285	N260Y	probably damaging	Het
Maneal	G	T	4: 124,856,690	Y424*	probably null	Het
Map4k2	T	G	19: 6,351,610	C677W	probably damaging	Het
Med6	T	C	12: 81,591,260	H59R	probably benign	Het
Mms22l	T	A	4: 24,536,245	D571E	probably benign	Het
Mroh8	A	G	2: 157,225,573	F622S	probably damaging	Het
Mrpl44	A	T	1: 79,776,257	Q42L	probably damaging	Het
Myh8	G	T	11: 67,283,377		probably benign	Het
Ndufb2	T	C	6: 39,592,652	V13A	probably benign	Het
Nf1	T	A	11: 79,425,616	L499Q	probably damaging	Het
Olfr1185-ps1	T	G	2: 88,499,511	V142G	probably damaging	Het
Olfr1281	T	A	2: 111,328,536	L39*	probably null	Het
Olfr1357	T	C	10: 78,611,864	Y259C	probably damaging	Het
Olfr782	T	C	10: 129,351,325	I254T	probably damaging	Het
Opa1	T	C	16: 29,629,632	C874R	probably damaging	Het
Pld3	T	A	7: 27,535,861	D314V	possibly damaging	Het
Pou6f1	A	C	15: 100,587,805	C114W	possibly damaging	Het
Pqlc3	A	G	12: 16,993,480	W150R	probably damaging	Het
Prl2c1	A	C	13: 27,849,406	Q2P	possibly damaging	Het
Prl2c1	G	T	13: 27,849,407	Q2H	probably benign	Het
Pzp	C	A	6: 128,494,738	K908N	probably damaging	Het
Rab6b	G	A	9: 103,162,626	G125D	probably damaging	Het
Rhbdd2	C	T	5: 135,635,131	T69I	probably benign	Het
Samd9l	A	T	6: 3,374,221	Y1013*	probably null	Het
Slc13a4	T	A	6: 35,283,295	T217S	probably benign	Het
Smarcad1	T	C	6: 65,072,049	L253S	probably benign	Het
Snrpa	C	A	7: 27,191,609	V146L	possibly damaging	Het
Srrt	A	T	5: 137,299,976	D311E	probably benign	Het
Stk32b	A	T	5: 37,649,139	F20L	probably damaging	Het
Sult2a7	T	C	7: 14,490,089	T136A	probably benign	Het
Sv2a	G	A	3: 96,187,080	V244I	probably benign	Het
Tesk1	T	A	4: 43,446,070		probably null	Het
Tmem260	A	G	14: 48,451,913	H63R	probably damaging	Het
Ugt1a6b	A	G	1: 88,107,072	E44G	probably benign	Het
Unc79	A	T	12: 103,108,254	I1363F	probably damaging	Het
Usp15	T	A	10: 123,153,048	N255Y	probably benign	Het
Usp35	A	G	7: 97,311,960	V753A	possibly damaging	Het
Usp35	T	C	7: 97,312,063	N719D	probably benign	Het
Vmn2r104	T	A	17: 20,042,726	I158L	probably benign	Het
Vmn2r69	A	T	7: 85,415,675	M1K	probably null	Het
Zan	C	T	5: 137,398,260	E4345K	unknown	Het
Zc3h7a	A	T	16: 11,147,283	M662K	possibly damaging	Het
Zfp512	G	A	5: 31,476,790	V438M	probably damaging	Het
Zfy1	T	C	Y: 738,945	D87G	unknown	Het
Zmym4	A	T	4: 126,906,026	V653E	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAGGTACCAAACTAGCATCC -3'
(R):5'- TCATGATCCACTTTGCTCAGG -3'

Sequencing Primer
(F):5'- TAGGTACCAAACTAGCATCCTCTTC -3'
(R):5'- TAGATCATGGTGTCATAACCCC -3'

Posted On

2021-04-30