Incidental Mutation 'R8795:Greb1l'
ID 671230
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 068636-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8795 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10553739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1580 (H1580R)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977]
AlphaFold B9EJV3
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: H1580R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H1580R

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (72/74)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,818,598 (GRCm39) M128L probably damaging Het
Abcc12 A G 8: 87,258,213 (GRCm39) S768P possibly damaging Het
Adamts8 A T 9: 30,854,484 (GRCm39) M118L probably benign Het
Adgrl4 A G 3: 151,216,416 (GRCm39) N533S probably benign Het
Agk T G 6: 40,363,854 (GRCm39) I278R possibly damaging Het
Atr T A 9: 95,749,584 (GRCm39) W466R probably damaging Het
Cacna1h C T 17: 25,612,538 (GRCm39) V387I probably damaging Het
Cand2 T G 6: 115,763,889 (GRCm39) D270E probably benign Het
Ccdc107 C T 4: 43,495,514 (GRCm39) T139M probably damaging Het
Cenpl A G 1: 160,910,584 (GRCm39) E177G probably benign Het
Clint1 C A 11: 45,775,178 (GRCm39) Q56K probably damaging Het
Col9a1 A G 1: 24,233,812 (GRCm39) R249G unknown Het
Cpne5 C T 17: 29,423,662 (GRCm39) probably benign Het
Ddx27 A G 2: 166,859,730 (GRCm39) D54G probably benign Het
Dync2h1 C T 9: 7,137,087 (GRCm39) E1468K probably benign Het
E130308A19Rik A T 4: 59,737,676 (GRCm39) N429I possibly damaging Het
Endov G T 11: 119,390,380 (GRCm39) G86C possibly damaging Het
Ercc5 A T 1: 44,203,089 (GRCm39) Y242F possibly damaging Het
Gabrr1 T A 4: 33,161,756 (GRCm39) V360E probably damaging Het
Gcn1 T C 5: 115,752,454 (GRCm39) I2153T probably benign Het
Gje1 T C 10: 14,593,870 (GRCm39) N8S probably benign Het
Grin1 C G 2: 25,187,468 (GRCm39) S614T probably damaging Het
Hmcn2 A G 2: 31,315,393 (GRCm39) N3714S probably benign Het
Idh1 CA CAA 1: 65,204,347 (GRCm39) probably null Het
Ifitm2 A T 7: 140,535,661 (GRCm39) H56Q probably damaging Het
Ifrd1 G A 12: 40,263,076 (GRCm39) T218I possibly damaging Het
Igkv1-99 G T 6: 68,519,370 (GRCm39) G109V Het
Impg2 A G 16: 56,080,611 (GRCm39) E805G probably benign Het
Itgb6 T A 2: 60,483,629 (GRCm39) N260Y probably damaging Het
Maneal G T 4: 124,750,483 (GRCm39) Y424* probably null Het
Map4k2 T G 19: 6,401,640 (GRCm39) C677W probably damaging Het
Med6 T C 12: 81,638,034 (GRCm39) H59R probably benign Het
Mms22l T A 4: 24,536,245 (GRCm39) D571E probably benign Het
Mroh8 A G 2: 157,067,493 (GRCm39) F622S probably damaging Het
Mrpl44 A T 1: 79,753,974 (GRCm39) Q42L probably damaging Het
Myh8 G T 11: 67,174,203 (GRCm39) probably benign Het
Ndufb2 T C 6: 39,569,586 (GRCm39) V13A probably benign Het
Nf1 T A 11: 79,316,442 (GRCm39) L499Q probably damaging Het
Opa1 T C 16: 29,448,450 (GRCm39) C874R probably damaging Het
Or1i2 T C 10: 78,447,698 (GRCm39) Y259C probably damaging Het
Or4c99 T G 2: 88,329,855 (GRCm39) V142G probably damaging Het
Or4k37 T A 2: 111,158,881 (GRCm39) L39* probably null Het
Or6c6 T C 10: 129,187,194 (GRCm39) I254T probably damaging Het
Pld3 T A 7: 27,235,286 (GRCm39) D314V possibly damaging Het
Pou6f1 A C 15: 100,485,686 (GRCm39) C114W possibly damaging Het
Prl2c1 A C 13: 28,033,389 (GRCm39) Q2P possibly damaging Het
Prl2c1 G T 13: 28,033,390 (GRCm39) Q2H probably benign Het
Pzp C A 6: 128,471,701 (GRCm39) K908N probably damaging Het
Rab6b G A 9: 103,039,825 (GRCm39) G125D probably damaging Het
Rhbdd2 C T 5: 135,663,985 (GRCm39) T69I probably benign Het
Samd9l A T 6: 3,374,221 (GRCm39) Y1013* probably null Het
Slc13a4 T A 6: 35,260,230 (GRCm39) T217S probably benign Het
Slc66a3 A G 12: 17,043,481 (GRCm39) W150R probably damaging Het
Smarcad1 T C 6: 65,049,033 (GRCm39) L253S probably benign Het
Snrpa C A 7: 26,891,034 (GRCm39) V146L possibly damaging Het
Spata31f1e A G 4: 42,792,992 (GRCm39) V380A probably benign Het
Srrt A T 5: 137,298,238 (GRCm39) D311E probably benign Het
Stk32b A T 5: 37,806,483 (GRCm39) F20L probably damaging Het
Sult2a7 T C 7: 14,224,014 (GRCm39) T136A probably benign Het
Sv2a G A 3: 96,094,396 (GRCm39) V244I probably benign Het
Tesk1 T A 4: 43,446,070 (GRCm39) probably null Het
Tmem260 A G 14: 48,689,370 (GRCm39) H63R probably damaging Het
Ugt1a6b A G 1: 88,034,794 (GRCm39) E44G probably benign Het
Unc79 A T 12: 103,074,513 (GRCm39) I1363F probably damaging Het
Usp15 T A 10: 122,988,953 (GRCm39) N255Y probably benign Het
Usp35 A G 7: 96,961,167 (GRCm39) V753A possibly damaging Het
Usp35 T C 7: 96,961,270 (GRCm39) N719D probably benign Het
Vmn2r104 T A 17: 20,262,988 (GRCm39) I158L probably benign Het
Vmn2r69 A T 7: 85,064,883 (GRCm39) M1K probably null Het
Zan C T 5: 137,396,522 (GRCm39) E4345K unknown Het
Zc3h7a A T 16: 10,965,147 (GRCm39) M662K possibly damaging Het
Zfp512 G A 5: 31,634,134 (GRCm39) V438M probably damaging Het
Zfy1 T C Y: 738,945 (GRCm39) D87G unknown Het
Zmym4 A T 4: 126,799,819 (GRCm39) V653E probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGGTACCAAACTAGCATCC -3'
(R):5'- TCATGATCCACTTTGCTCAGG -3'

Sequencing Primer
(F):5'- TAGGTACCAAACTAGCATCCTCTTC -3'
(R):5'- TAGATCATGGTGTCATAACCCC -3'
Posted On 2021-04-30