Incidental Mutation 'R8796:Olfr1036'
ID671236
Institutional Source Beutler Lab
Gene Symbol Olfr1036
Ensembl Gene ENSMUSG00000099820
Gene Nameolfactory receptor 1036
SynonymsGA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R8796 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86073992-86077194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86075174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 145 (V145M)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164985
AA Change: V145M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: V145M

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,629,482 T182S possibly damaging Het
Abca12 A C 1: 71,258,089 probably benign Het
Aco1 T A 4: 40,179,037 D345E probably benign Het
Acp6 T C 3: 97,159,193 V9A probably benign Het
Akap1 A C 11: 88,839,672 I597S probably damaging Het
B4galnt4 C T 7: 141,067,575 T385I probably damaging Het
Bbof1 A T 12: 84,413,294 T112S possibly damaging Het
Chd7 C A 4: 8,838,691 H1297N probably damaging Het
Cldn15 T C 5: 136,974,497 F147L probably damaging Het
Coq7 C T 7: 118,527,417 E143K probably damaging Het
Ctnnb1 A G 9: 120,955,432 N430S probably damaging Het
Cxcl12 G T 6: 117,178,592 K92N possibly damaging Het
Dscaml1 T C 9: 45,447,728 F95S probably damaging Het
Epha5 T A 5: 84,107,991 H480L probably damaging Het
Fbxo30 G A 10: 11,289,576 C14Y probably damaging Het
Gja5 A G 3: 97,051,103 I159V possibly damaging Het
Herc2 A T 7: 56,135,375 Q1487L probably benign Het
Hipk2 T A 6: 38,698,223 Q1168L probably damaging Het
Kcnk12 T A 17: 87,746,592 Y214F probably damaging Het
Kif5b T C 18: 6,226,965 K98E probably benign Het
Lama1 T A 17: 67,810,151 N2480K Het
Lrp1b A G 2: 40,903,414 C2610R Het
Mast4 T C 13: 102,783,391 Y536C probably benign Het
Ntrk1 A G 3: 87,783,115 S407P probably benign Het
Ogdh T A 11: 6,347,129 M527K possibly damaging Het
Olfr65 T C 7: 103,906,994 V182A Het
Plxdc1 A G 11: 97,956,581 S89P probably benign Het
Prdm2 A G 4: 143,133,447 I1091T probably benign Het
Psg16 C A 7: 17,093,889 H166N possibly damaging Het
Qrfpr T A 3: 36,180,196 Y332F probably damaging Het
Rab31 A T 17: 65,772,534 I4K possibly damaging Het
Rasgrf2 T C 13: 91,890,566 S453G Het
Rxfp2 C T 5: 150,018,797 probably benign Het
S100a8 A G 3: 90,669,558 E6G probably damaging Het
Sart1 T C 19: 5,388,348 K94E probably damaging Het
Sema4d A T 13: 51,711,510 F297I probably damaging Het
Sgk2 A G 2: 163,006,803 K287E probably damaging Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Skint6 G T 4: 112,804,694 T1231K possibly damaging Het
Slc35b3 C T 13: 38,937,746 probably benign Het
Slf1 A T 13: 77,066,665 M634K probably benign Het
Slit2 A G 5: 48,302,848 D1424G probably benign Het
Snx21 G A 2: 164,786,829 V131I possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tas1r3 A G 4: 155,861,391 V516A probably benign Het
Tas2r120 A T 6: 132,657,118 R54S probably damaging Het
Tmem109 A T 19: 10,872,631 L99Q probably damaging Het
Tnfrsf1b A G 4: 145,219,915 S309P possibly damaging Het
Trav11 C T 14: 53,519,770 A85V probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttn G A 2: 76,822,970 R12631C possibly damaging Het
Vmn2r10 T A 5: 108,996,051 T678S possibly damaging Het
Vmn2r124 T C 17: 18,062,671 M209T possibly damaging Het
Vmn2r24 A T 6: 123,780,541 M123L probably benign Het
Wdr41 T G 13: 95,015,067 L245R possibly damaging Het
Wwp2 G T 8: 107,556,557 G814W probably null Het
Other mutations in Olfr1036
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr1036 APN 2 86075472 missense possibly damaging 0.90
IGL02370:Olfr1036 APN 2 86074788 missense probably damaging 0.98
R0269:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0409:Olfr1036 UTSW 2 86075302 nonsense probably null
R0412:Olfr1036 UTSW 2 86075091 missense probably benign 0.16
R0617:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0846:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R1251:Olfr1036 UTSW 2 86074820 missense probably benign 0.20
R1646:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
R1670:Olfr1036 UTSW 2 86075250 missense probably benign
R1775:Olfr1036 UTSW 2 86074760 missense possibly damaging 0.88
R1968:Olfr1036 UTSW 2 86075205 missense probably damaging 1.00
R2877:Olfr1036 UTSW 2 86075331 missense possibly damaging 0.82
R4639:Olfr1036 UTSW 2 86075579 missense probably benign 0.24
R4957:Olfr1036 UTSW 2 86075510 missense probably damaging 1.00
R5267:Olfr1036 UTSW 2 86075538 missense probably benign 0.28
R5862:Olfr1036 UTSW 2 86075646 missense probably benign 0.00
R6235:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R6355:Olfr1036 UTSW 2 86074872 missense probably benign 0.04
R6943:Olfr1036 UTSW 2 86074920 missense probably damaging 1.00
R8033:Olfr1036 UTSW 2 86074875 missense possibly damaging 0.61
R8861:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
Z1088:Olfr1036 UTSW 2 86075323 missense possibly damaging 0.66
Z1177:Olfr1036 UTSW 2 86075424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATCAGCATCAGCCTGCAG -3'
(R):5'- TGTGAAGTTAATGCCAGCAATGAC -3'

Sequencing Primer
(F):5'- TGTTACCCCCAAAATGCTGG -3'
(R):5'- CAATCATTGTGTACTCTTTGATATGC -3'
Posted On2021-04-30