Incidental Mutation 'R8796:Skint6'
ID 671246
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8796 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112804616-113286973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 112804694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1231 (T1231K)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: T1231K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: T1231K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: T1231K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: T1231K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,629,482 T182S possibly damaging Het
Abca12 A C 1: 71,258,089 probably benign Het
Aco1 T A 4: 40,179,037 D345E probably benign Het
Acp6 T C 3: 97,159,193 V9A probably benign Het
Akap1 A C 11: 88,839,672 I597S probably damaging Het
B4galnt4 C T 7: 141,067,575 T385I probably damaging Het
Bbof1 A T 12: 84,413,294 T112S possibly damaging Het
Chd7 C A 4: 8,838,691 H1297N probably damaging Het
Cldn15 T C 5: 136,974,497 F147L probably damaging Het
Coq7 C T 7: 118,527,417 E143K probably damaging Het
Ctnnb1 A G 9: 120,955,432 N430S probably damaging Het
Cxcl12 G T 6: 117,178,592 K92N possibly damaging Het
Dscaml1 T C 9: 45,447,728 F95S probably damaging Het
Epha5 T A 5: 84,107,991 H480L probably damaging Het
Fbxo30 G A 10: 11,289,576 C14Y probably damaging Het
Gja5 A G 3: 97,051,103 I159V possibly damaging Het
Herc2 A T 7: 56,135,375 Q1487L probably benign Het
Hipk2 T A 6: 38,698,223 Q1168L probably damaging Het
Kcnk12 T A 17: 87,746,592 Y214F probably damaging Het
Kif5b T C 18: 6,226,965 K98E probably benign Het
Lama1 T A 17: 67,810,151 N2480K Het
Lrp1b A G 2: 40,903,414 C2610R Het
Mast4 T C 13: 102,783,391 Y536C probably benign Het
Ntrk1 A G 3: 87,783,115 S407P probably benign Het
Ogdh T A 11: 6,347,129 M527K possibly damaging Het
Olfr1036 G A 2: 86,075,174 V145M possibly damaging Het
Olfr65 T C 7: 103,906,994 V182A Het
Plxdc1 A G 11: 97,956,581 S89P probably benign Het
Prdm2 A G 4: 143,133,447 I1091T probably benign Het
Psg16 C A 7: 17,093,889 H166N possibly damaging Het
Qrfpr T A 3: 36,180,196 Y332F probably damaging Het
Rab31 A T 17: 65,772,534 I4K possibly damaging Het
Ranbp10 C A 8: 105,773,033 probably benign Het
Rasgrf2 T C 13: 91,890,566 S453G Het
Rxfp2 C T 5: 150,018,797 probably benign Het
S100a8 A G 3: 90,669,558 E6G probably damaging Het
Sart1 T C 19: 5,388,348 K94E probably damaging Het
Sema4d A T 13: 51,711,510 F297I probably damaging Het
Sgk2 A G 2: 163,006,803 K287E probably damaging Het
Sgsm1 T A 5: 113,263,257 T868S probably benign Het
Slc35b3 C T 13: 38,937,746 probably benign Het
Slf1 A T 13: 77,066,665 M634K probably benign Het
Slit2 A G 5: 48,302,848 D1424G probably benign Het
Snx21 G A 2: 164,786,829 V131I possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tas1r3 A G 4: 155,861,391 V516A probably benign Het
Tas2r120 A T 6: 132,657,118 R54S probably damaging Het
Tmem109 A T 19: 10,872,631 L99Q probably damaging Het
Tnfrsf1b A G 4: 145,219,915 S309P possibly damaging Het
Trav11 C T 14: 53,519,770 A85V probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttn G A 2: 76,822,970 R12631C possibly damaging Het
Vmn2r10 T A 5: 108,996,051 T678S possibly damaging Het
Vmn2r124 T C 17: 18,062,671 M209T possibly damaging Het
Vmn2r24 A T 6: 123,780,541 M123L probably benign Het
Wdr41 T G 13: 95,015,067 L245R possibly damaging Het
Wwp2 G T 8: 107,556,557 G814W probably null Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
meissner UTSW 4 112804694 missense possibly damaging 0.86
Tegmentum UTSW 4 112842822 splice site probably null
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 splice site probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 splice site probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 splice site probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 splice site probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7461:Skint6 UTSW 4 113177046 splice site probably null
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113177046 splice site probably null
R7956:Skint6 UTSW 4 112846697 missense possibly damaging 0.85
R8118:Skint6 UTSW 4 112865675 missense possibly damaging 0.53
R8118:Skint6 UTSW 4 113156494 missense possibly damaging 0.73
R8197:Skint6 UTSW 4 112894843 splice site probably null
R8218:Skint6 UTSW 4 112839274 splice site probably null
R8344:Skint6 UTSW 4 113236445 missense probably damaging 1.00
R8518:Skint6 UTSW 4 113238268 missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113192672 missense possibly damaging 0.73
R8812:Skint6 UTSW 4 112988952 missense probably benign 0.00
R8866:Skint6 UTSW 4 112854453 missense probably benign
R8881:Skint6 UTSW 4 112815519 missense possibly damaging 0.53
R8949:Skint6 UTSW 4 113074099 missense probably benign 0.04
R8967:Skint6 UTSW 4 112872504 nonsense probably null
R9005:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9007:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9053:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9055:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9144:Skint6 UTSW 4 113127905 missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113176976 missense probably damaging 0.98
R9297:Skint6 UTSW 4 112811520 missense probably benign 0.00
R9388:Skint6 UTSW 4 113192641 missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113177027 missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112806840 critical splice donor site probably null
R9515:Skint6 UTSW 4 112858178 missense probably benign
R9572:Skint6 UTSW 4 113127931 missense probably benign
R9689:Skint6 UTSW 4 113236349 missense probably damaging 0.99
R9744:Skint6 UTSW 4 112809163 missense probably damaging 1.00
R9785:Skint6 UTSW 4 112883687 missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 112892014 missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113238294 missense probably damaging 0.96
Z1176:Skint6 UTSW 4 113238295 missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112806928 missense possibly damaging 0.96
Z1177:Skint6 UTSW 4 113105961 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTCAGGCCCCACGTTG -3'
(R):5'- ATGCTATACCTTCCCAAATTCAAAA -3'

Sequencing Primer
(F):5'- GATCGCTGCTTTCTCAGGACAG -3'
(R):5'- AGAGCCTCAATAGCCCAGTGTTTG -3'
Posted On 2021-04-30